Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_co8389475.1

Orthogroup ID

OG0002480

Physical Location & Seq

Genomic Coordinates Reverse (-)

1 .. 1195

Gene Structure 1195 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_co8389475.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 525 bp

atgtggatcagtgaacaacaacccttgcgcttgaatccagctgaggtttgtgaggtcattgctgcagtttgctctgaggcatcttcaccaactgctaatgtgatgacagtatcatctagattaaataataactatggaaagccgtcaatggatgcagcagtgagcgtcttaatcaaacttgttattgacatgtatgttttggattctgggactgctgctcctctcactttgtctatgcttcaggaaatgcttaattctccaacagcaacatgtagagttcgtgcatttgatttcattctgaaccttggagttcatgctcatttactagagccaatggttacggatgatgcttccacaattgaagaagattattctcaagaatcatattttgacagtgaagctaagcttgcaacacaagaaatgagaagatcagattctgttttgatgggcagctcctcagctattgataattttgaatcatggattttaaatattttatatgagattttgcttcttcttgttcag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

175

Amino Acids

19.3

Weight (kDa)

4.25

Isoelectric Point (pI)

58.72

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0002480)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT3G12590 AT3G12590
fragaria_vesca	FvH4_7g21970 FvH4_7g21970 FvH4_7g21970 FvH4_7g21970 FvH4_7g21970 FvH4_7g21970 FvH4_7g21970 FvH4_7g21970 FvH4_7g22001 FvH4_7g22001
malus_domestica	MD01G1124000.v1.1 MD07G1194200.v1.1
prunus_persica	Prupe.2G231600_v2.0.a1 Prupe.2G231600_v2.0.a1 Prupe.2G231600_v2.0.a1 Prupe.2G231600_v2.0.a1 Prupe.2G231600_v2.0.a1 Prupe.2G231600_v2.0.a1 Prupe.2G231600_v2.0.a1 Prupe.2G231600_v2.0.a1 Prupe.2G231600_v2.0.a1 Prupe.2G231600_v2.0.a1
pyrus_communis	pycom01g15050 pycom07g18300
rosa_chinensis	RchiOBHm_Chr1g0366301
rosa_laevigata	RLG00000027354
rosa_multiflora	Rmu_co8229963.1_g000001 Rmu_co8389475.1_g000001 Rmu_ssc0000250.1_g000001
rosa_roxburghii	Rroxscaffold_4G00290010 Rroxscaffold_4G00290260
rosa_rugosa	Rorug01G0328600 Rorug01G0328600 Rorug01G0328700.1
rosa_samantha	Rh1AG336900 Rh1BG298500 Rh1CG313800 Rh1DG329900
rosa_wichuraiana	Rw1G029870

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AclWI	GGATC	1 cut(s)	14
AcuI	CTGAAG	1 cut(s)	224
AflIII	ACRYGT	2 cut(s)	189, 269
AgsI	TTSAA	3 cut(s)	34, 362, 476
AluBI	AGCT	5 cut(s)	41, 401, 406, 453, 461
AluI	AGCT	5 cut(s)	41, 401, 406, 453, 461
AlwI	GGATC	1 cut(s)	14
AlwNI	CAGNNNCTG	1 cut(s)	437
ApeKI	GCWGC	4 cut(s)	62, 155, 215, 450
AspLEI	GCGC	1 cut(s)	30
AsuHPI	GGTGA	1 cut(s)	78
BbvCI	CCTCAGC	2 cut(s)	42, 457
BbvI	GCAGC	4 cut(s)	49, 167, 202, 462
BccI	CCATC	1 cut(s)	439
BceAI	ACGGC	1 cut(s)	127
BfaI	CTAG	2 cut(s)	117, 326
BfmI	CTRYAG	1 cut(s)	63
BisI	GCNGC	4 cut(s)	63, 156, 216, 451
BlpI	GCTNAGC	1 cut(s)	402
BlsI	GCNGC	4 cut(s)	64, 157, 217, 452
BmsI	GCATC	3 cut(s)	89, 142, 337
Bpu10I	CCTNAGC	2 cut(s)	42, 457
Bpu1102I	GCTNAGC	1 cut(s)	402
BpuEI	CTTGAG	1 cut(s)	360
BsaJI	CCNNGG	1 cut(s)	304
BsaXI	ACNNNNNCTCC	2 cut(s)	202, 232
Bse3DI	GCAATG	1 cut(s)	57
BseDI	CCNNGG	1 cut(s)	304
BseGI	GGATG	2 cut(s)	157, 349
BseMI	GCAATG	1 cut(s)	57
BseMII	CTCAG	3 cut(s)	33, 66, 471
BseRI	GAGGAG	2 cut(s)	210, 445
BseXI	GCAGC	4 cut(s)	49, 167, 202, 462
BslFI	GGGAC	1 cut(s)	223
BsmFI	GGGAC	1 cut(s)	223
Bsp143I	GATC	2 cut(s)	6, 428
Bsp1720I	GCTNAGC	1 cut(s)	402
BspCNI	CTCAG	3 cut(s)	34, 67, 470
BspMAI	CTGCAG	1 cut(s)	67
BspPI	GGATC	1 cut(s)	14
BsrDI	GCAATG	1 cut(s)	57
BssECI	CCNNGG	1 cut(s)	304
BssMI	GATC	2 cut(s)	6, 428
BssT1I	CCWWGG	1 cut(s)	304
Bst4CI	ACNGT	2 cut(s)	109, 395
BstC8I	GCNNGC	1 cut(s)	408
BstDEI	CTNAG	4 cut(s)	42, 75, 402, 457
BstF5I	GGATG	2 cut(s)	157, 349
BstHHI	GCGC	1 cut(s)	30
BstKTI	GATC	2 cut(s)	9, 431
BstMBI	GATC	2 cut(s)	6, 428
BstMWI	GCNNNNNNNGC	1 cut(s)	407
BstNSI	RCATGY	2 cut(s)	193, 273
BstSFI	CTRYAG	1 cut(s)	63
BstV1I	GCAGC	4 cut(s)	49, 167, 202, 462
BtsCI	GGATG	2 cut(s)	157, 349
BtsI	GCAGTG	1 cut(s)	165
BtsIMutI	CAGTG	3 cut(s)	16, 165, 400
Cac8I	GCNNGC	1 cut(s)	408
CaiI	CAGNNNCTG	1 cut(s)	437
CfoI	GCGC	1 cut(s)	30
CseI	GACGC	1 cut(s)	154
CviAII	CATG	4 cut(s)	190, 270, 314, 480
CviJI	RGCY	7 cut(s)	41, 142, 331, 401, 406, 453, 461
CviKI_1	RGCY	7 cut(s)	41, 142, 331, 401, 406, 453, 461
DdeI	CTNAG	4 cut(s)	42, 75, 402, 457
DpnI	GATC	2 cut(s)	8, 430
DpnII	GATC	2 cut(s)	6, 428
DraI	TTTAAA	1 cut(s)	489
Eco130I	CCWWGG	1 cut(s)	304
Eco57I	CTGAAG	1 cut(s)	224
EcoT14I	CCWWGG	1 cut(s)	304
ErhI	CCWWGG	1 cut(s)	304
FaeI	CATG	4 cut(s)	193, 273, 317, 483
FalI	AAGNNNNNCTT	2 cut(s)	390, 422
FaqI	GGGAC	1 cut(s)	223
FatI	CATG	4 cut(s)	189, 269, 313, 479
Fnu4HI	GCNGC	4 cut(s)	63, 156, 216, 451
FokI	GGATG	2 cut(s)	164, 356
Fsp4HI	GCNGC	4 cut(s)	63, 156, 216, 451
FspBI	CTAG	2 cut(s)	117, 326
GlaI	GCGC	1 cut(s)	29
GluI	GCNGC	4 cut(s)	63, 156, 216, 451
HgaI	GACGC	1 cut(s)	154
HhaI	GCGC	1 cut(s)	30
Hin1II	CATG	4 cut(s)	193, 273, 317, 483
Hin6I	GCGC	1 cut(s)	28
HinP1I	GCGC	1 cut(s)	28
HindIII	AAGCTT	1 cut(s)	404
HinfI	GANTC	5 cut(s)	34, 203, 380, 434, 476
HphI	GGTGA	1 cut(s)	78
Hpy166II	GTNNAC	1 cut(s)	14
Hpy188I	TCNGA	3 cut(s)	76, 300, 433
Hpy188III	TCNNGA	3 cut(s)	117, 242, 377
Hpy8I	GTNNAC	1 cut(s)	14
HpyCH4III	ACNGT	2 cut(s)	109, 395
HpyCH4V	TGCA	4 cut(s)	65, 155, 284, 410
HpyF10VI	GCNNNNNNNGC	1 cut(s)	407
HpyF3I	CTNAG	4 cut(s)	42, 75, 402, 457
Hsp92II	CATG	4 cut(s)	193, 273, 317, 483
HspAI	GCGC	1 cut(s)	28
Kzo9I	GATC	2 cut(s)	6, 428
LmnI	GCTCC	2 cut(s)	223, 458
LpnPI	CCDG	3 cut(s)	51, 192, 227
Lsp1109I	GCAGC	4 cut(s)	49, 167, 202, 462
LweI	GCATC	3 cut(s)	89, 142, 337
MaeI	CTAG	2 cut(s)	117, 326
MaeIII	GTNAC	1 cut(s)	337
MalI	GATC	2 cut(s)	8, 430
MboI	GATC	2 cut(s)	6, 428
MboII	GAAGA	5 cut(s)	75, 374, 377, 438, 506
MfeI	CAATTG	1 cut(s)	357
MluCI	AATT	3 cut(s)	253, 357, 469
MmeI	TCCRAC	1 cut(s)	284
MnlI	CCTC	5 cut(s)	37, 46, 70, 231, 466
MseI	TTAA	4 cut(s)	122, 170, 252, 488
MspA1I	CMGCKG	1 cut(s)	41
MunI	CAATTG	1 cut(s)	357
MwoI	GCNNNNNNNGC	1 cut(s)	407
NdeII	GATC	2 cut(s)	6, 428
NlaIII	CATG	4 cut(s)	193, 273, 317, 483
NspI	RCATGY	2 cut(s)	193, 273
PciI	ACATGT	2 cut(s)	189, 269
PfeI	GAWTC	5 cut(s)	34, 203, 380, 434, 476
PkrI	GCNGC	4 cut(s)	64, 157, 217, 452
PscI	ACATGT	2 cut(s)	189, 269
PstI	CTGCAG	1 cut(s)	67
PstNI	CAGNNNCTG	1 cut(s)	437
PvuII	CAGCTG	1 cut(s)	41
SaqAI	TTAA	4 cut(s)	122, 170, 252, 488
SatI	GCNGC	4 cut(s)	63, 156, 216, 451
Sau3AI	GATC	2 cut(s)	6, 428
SetI	ASST	8 cut(s)	43, 48, 57, 306, 403, 408, 455, 463
SfaNI	GCATC	3 cut(s)	89, 142, 337
SfcI	CTRYAG	1 cut(s)	63
SmlI	CTYRAG	1 cut(s)	375
SmoI	CTYRAG	1 cut(s)	375
Sse9I	AATT	3 cut(s)	253, 357, 469
SspI	AATATT	1 cut(s)	493
SspMI	CTAG	2 cut(s)	117, 326
StyI	CCWWGG	1 cut(s)	304
TaaI	ACNGT	2 cut(s)	109, 395
TasI	AATT	3 cut(s)	253, 357, 469
TfiI	GAWTC	5 cut(s)	34, 203, 380, 434, 476
Tru1I	TTAA	4 cut(s)	122, 170, 252, 488
Tru9I	TTAA	4 cut(s)	122, 170, 252, 488
TscAI	CASTG	3 cut(s)	16, 165, 400
TseI	GCWGC	4 cut(s)	62, 155, 215, 450
TspDTI	ATGAA	2 cut(s)	283, 302
TspGWI	ACGGA	1 cut(s)	356
TspRI	CASTG	3 cut(s)	16, 165, 400
XbaI	TCTAGA	1 cut(s)	116
XceI	RCATGY	2 cut(s)	193, 273
XspI	CTAG	2 cut(s)	117, 326

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.