Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_co8443991.1

Orthogroup ID

OG0013764

Physical Location & Seq

Genomic Coordinates Forward (+)

1 .. 1621

Gene Structure 1621 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_co8443991.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 466 bp

ctctgcgtctgcgattgataacaaggaacaaggcattcctacagattttatgatgagcatccagtcagagtcacaaagaaatggaaatggggggtcagagctgcaaaaagatgaaaatgaggggtcagaatcacagaaagatggaaatgggagatgcgaaatctcaaatgggacttatagtaaagatgctaaactagtggaaagctccggcagcacaattgatggtaacgagatattagctctggtggaatggttaaattatatcgttccttatttaagattgccgacggatgcttctgaggaggaaatcagagcctgcttaattgatggcactgttttatgcagaattttaaataagctgtgtcctggttcagttgaaatgggagggagttcagaccctggttttgcaaatgtcaaaaggtttctggtggctgtggaggagttaggattccctccgtttgagctt

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003774 GO:0003777 GO:0003824 GO:0005575 GO:0005622 GO:0005623 GO:0005856 GO:0005871 GO:0005875 GO:0005886 GO:0006928 GO:0007017 GO:0007018 GO:0008150 GO:0009987 GO:0015630 GO:0016020 GO:0016462 GO:0016787 GO:0016817 GO:0016818 GO:0016887 GO:0017111 GO:0032991 GO:0043226 GO:0043228 GO:0043229 GO:0043232 GO:0044422 GO:0044424 GO:0044430 GO:0044446 GO:0044464 GO:0071944

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

CH Kinesin Microtub_bd

Protein Analysis

155

Amino Acids

16.74

Weight (kDa)

4.32

Isoelectric Point (pI)

55.44

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0013764)

Species	Orthologous Gene IDs
rosa_chinensis	RchiOBHm_Chr5g0069471 RchiOBHm_Chr5g0069531
rosa_laevigata	RLG00000001259 RLG00000009439 RLG00000036056
rosa_multiflora	Rmu_co8443991.1_g000001 Rmu_sc0000738.1_g000039
rosa_roxburghii	Rroxscaffold_1G00011460 Rroxscaffold_1G00015510
rosa_rugosa	Rorug05G0582200
rosa_samantha	Rh5AG455400 Rh5BG474200 Rh5BG474500 Rh5CG496600 Rh5CG496900 Rh5DG486000 Rh7BG340900
rosa_wichuraiana	Rw0G023030

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AcsI	RAATTY	1 cut(s)	346
AgsI	TTSAA	1 cut(s)	378
AhlI	ACTAGT	1 cut(s)	194
AjnI	CCWGG	2 cut(s)	365, 398
AluBI	AGCT	5 cut(s)	101, 205, 240, 359, 464
AluI	AGCT	5 cut(s)	101, 205, 240, 359, 464
AlwNI	CAGNNNCTG	2 cut(s)	316, 399
ApeKI	GCWGC	2 cut(s)	101, 211
ApoI	RAATTY	1 cut(s)	346
ArsI	GACNNNNNNTTYG	2 cut(s)	387, 419
BbvI	GCAGC	2 cut(s)	88, 223
BccI	CCATC	3 cut(s)	135, 216, 321
BciT130I	CCWGG	2 cut(s)	367, 400
BcuI	ACTAGT	1 cut(s)	194
BfaI	CTAG	1 cut(s)	195
BfmI	CTRYAG	1 cut(s)	40
BisI	GCNGC	2 cut(s)	102, 212
BlsI	GCNGC	2 cut(s)	103, 213
Bme1390I	CCNGG	2 cut(s)	367, 400
BmrFI	CCNGG	2 cut(s)	367, 400
BmsI	GCATC	4 cut(s)	67, 144, 176, 281
BsaBI	GATNNNNATC	1 cut(s)	57
BsaJI	CCNNGG	1 cut(s)	398
Bse1I	ACTGG	1 cut(s)	62
Bse8I	GATNNNNATC	1 cut(s)	57
BseBI	CCWGG	2 cut(s)	367, 400
BseDI	CCNNGG	1 cut(s)	398
BseGI	GGATG	2 cut(s)	58, 296
BseJI	GATNNNNATC	1 cut(s)	57
BseMII	CTCAG	1 cut(s)	289
BseNI	ACTGG	1 cut(s)	62
BseRI	GAGGAG	2 cut(s)	315, 453
BseXI	GCAGC	2 cut(s)	88, 223
BsiSI	CCGG	1 cut(s)	208
BslFI	GGGAC	1 cut(s)	185
BsmFI	GGGAC	1 cut(s)	185
BsmI	GAATGC	1 cut(s)	34
BspCNI	CTCAG	1 cut(s)	290
BsrI	ACTGG	1 cut(s)	62
BssECI	CCNNGG	1 cut(s)	398
Bst2UI	CCWGG	2 cut(s)	367, 400
Bst4CI	ACNGT	1 cut(s)	335
BstC8I	GCNNGC	1 cut(s)	317
BstDEI	CTNAG	1 cut(s)	298
BstF5I	GGATG	2 cut(s)	58, 296
BstMWI	GCNNNNNNNGC	1 cut(s)	211
BstNI	CCWGG	2 cut(s)	367, 400
BstSCI	CCNGG	2 cut(s)	365, 398
BstSFI	CTRYAG	1 cut(s)	40
BstV1I	GCAGC	2 cut(s)	88, 223
BtsCI	GGATG	2 cut(s)	58, 296
BtsIMutI	CAGTG	1 cut(s)	331
Cac8I	GCNNGC	1 cut(s)	317
CaiI	CAGNNNCTG	2 cut(s)	316, 399
CviJI	RGCY	7 cut(s)	101, 205, 240, 315, 359, 432, 464
CviKI_1	RGCY	7 cut(s)	101, 205, 240, 315, 359, 432, 464
DdeI	CTNAG	1 cut(s)	298
DraI	TTTAAA	1 cut(s)	352
EcoRII	CCWGG	2 cut(s)	365, 398
FaiI	YATR	4 cut(s)	51, 178, 262, 341
FaqI	GGGAC	1 cut(s)	185
Fnu4HI	GCNGC	2 cut(s)	102, 212
FokI	GGATG	2 cut(s)	45, 303
Fsp4HI	GCNGC	2 cut(s)	102, 212
FspBI	CTAG	1 cut(s)	195
GluI	GCNGC	2 cut(s)	102, 212
HapII	CCGG	1 cut(s)	208
HinfI	GANTC	3 cut(s)	69, 129, 448
HpaII	CCGG	1 cut(s)	208
Hpy188I	TCNGA	6 cut(s)	68, 98, 128, 299, 312, 395
Hpy99I	CGWCG	1 cut(s)	290
HpyCH4III	ACNGT	1 cut(s)	335
HpyCH4V	TGCA	3 cut(s)	104, 343, 408
HpyF10VI	GCNNNNNNNGC	1 cut(s)	211
HpyF3I	CTNAG	1 cut(s)	298
LmnI	GCTCC	1 cut(s)	210
LpnPI	CCDG	9 cut(s)	75, 221, 228, 329, 352, 379, 385, 411, 412
Lsp1109I	GCAGC	2 cut(s)	88, 223
LweI	GCATC	4 cut(s)	67, 144, 176, 281
MaeI	CTAG	1 cut(s)	195
MaeIII	GTNAC	2 cut(s)	70, 225
MfeI	CAATTG	1 cut(s)	217
MluCI	AATT	4 cut(s)	217, 257, 322, 346
MlyI	GAGTC	1 cut(s)	78
MnlI	CCTC	6 cut(s)	113, 293, 296, 378, 431, 463
MseI	TTAA	4 cut(s)	255, 276, 321, 351
MspI	CCGG	1 cut(s)	208
MspR9I	CCNGG	2 cut(s)	367, 400
MunI	CAATTG	1 cut(s)	217
Mva1269I	GAATGC	1 cut(s)	34
MvaI	CCWGG	2 cut(s)	367, 400
MwoI	GCNNNNNNNGC	1 cut(s)	211
NmuCI	GTSAC	1 cut(s)	70
PctI	GAATGC	1 cut(s)	34
PfeI	GAWTC	2 cut(s)	129, 448
PkrI	GCNGC	2 cut(s)	103, 213
PleI	GAGTC	1 cut(s)	77
PpsI	GAGTC	1 cut(s)	77
Psp6I	CCWGG	2 cut(s)	365, 398
PspGI	CCWGG	2 cut(s)	365, 398
PstNI	CAGNNNCTG	2 cut(s)	316, 399
SaqAI	TTAA	4 cut(s)	255, 276, 321, 351
SatI	GCNGC	2 cut(s)	102, 212
SchI	GAGTC	1 cut(s)	78
ScrFI	CCNGG	2 cut(s)	367, 400
SetI	ASST	6 cut(s)	103, 207, 242, 361, 423, 466
SfaNI	GCATC	4 cut(s)	67, 144, 176, 281
SfcI	CTRYAG	1 cut(s)	40
SpeI	ACTAGT	1 cut(s)	194
Sse9I	AATT	4 cut(s)	217, 257, 322, 346
SspMI	CTAG	1 cut(s)	195
StyD4I	CCNGG	2 cut(s)	365, 398
TaaI	ACNGT	1 cut(s)	335
TasI	AATT	4 cut(s)	217, 257, 322, 346
TfiI	GAWTC	2 cut(s)	129, 448
Tru1I	TTAA	4 cut(s)	255, 276, 321, 351
Tru9I	TTAA	4 cut(s)	255, 276, 321, 351
TscAI	CASTG	1 cut(s)	338
TseFI	GTSAC	1 cut(s)	70
TseI	GCWGC	2 cut(s)	101, 211
Tsp45I	GTSAC	1 cut(s)	70
TspDTI	ATGAA	1 cut(s)	127
TspGWI	ACGGA	2 cut(s)	303, 445
TspRI	CASTG	1 cut(s)	338
XapI	RAATTY	1 cut(s)	346
XspI	CTAG	1 cut(s)	195

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.