Rw0G023030

No description available

Basic Information

Type: gene
Biological Identity
rosa_wichuraiana
Contig01074
Physical Location & Seq
Reverse (-)
7435 .. 8784
1350 bp
Loading structure...
UTR
Exon/CDS
Intron
Rw0G023030.1

Sequence Viewer

Length: 243 bp
ATGGACAAACCTTGGCCATCAATGAGCTCTGCATCCGCAATTGATAACAAGGAACAAGGCATTCCTACAGATTTTATGATGAGCATCCGGTCAGAGTTACACAAAAATGGAAACAGGGGGGAGGGAGTTCAGACCCTGGTTTTTGCAAATGTCATAAGGTTTCTGGTGGCTGTGGAGGAGTTAAGATTCCCTCCGTTTGAGTTAAGATTTGCTAGAAAACCTGATCAAGAAGAGCATATGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

80

Amino Acids

9.21

Weight (kDa)

5.61

Isoelectric Point (pI)

51.64

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 36
AcoI YGGCCR 1 cut(s) 14
AjnI CCWGG 1 cut(s) 135
AluBI AGCT 1 cut(s) 27
AluI AGCT 1 cut(s) 27
Alw21I GWGCWC 1 cut(s) 29
AlwNI CAGNNNCTG 1 cut(s) 136
AoxI GGCC 1 cut(s) 14
BalI TGGCCA 1 cut(s) 16
BanII GRGCYC 1 cut(s) 29
Bbv12I GWGCWC 1 cut(s) 29
BccI CCATC 1 cut(s) 25
BciT130I CCWGG 1 cut(s) 137
BclI TGATCA 1 cut(s) 223
BfaI CTAG 1 cut(s) 213
BfmI CTRYAG 1 cut(s) 66
Bme1390I CCNGG 1 cut(s) 137
BmrFI CCNGG 1 cut(s) 137
BmsI GCATC 2 cut(s) 41, 93
BsaBI GATNNNNATC 1 cut(s) 83
BsaJI CCNNGG 2 cut(s) 11, 135
BsaWI WCCGGW 1 cut(s) 87
Bse8I GATNNNNATC 1 cut(s) 83
BseBI CCWGG 1 cut(s) 137
BseDI CCNNGG 2 cut(s) 11, 135
BseGI GGATG 2 cut(s) 32, 84
BseJI GATNNNNATC 1 cut(s) 83
BseRI GAGGAG 1 cut(s) 191
BshFI GGCC 1 cut(s) 16
BsiHKAI GWGCWC 1 cut(s) 29
BsiSI CCGG 1 cut(s) 88
BsmI GAATGC 1 cut(s) 60
BsnI GGCC 1 cut(s) 16
Bsp1286I GDGCHC 1 cut(s) 29
Bsp143I GATC 1 cut(s) 223
BspACI CCGC 1 cut(s) 36
BspANI GGCC 1 cut(s) 16
BspQI GCTCTTC 1 cut(s) 225
BssECI CCNNGG 2 cut(s) 11, 135
BssMI GATC 1 cut(s) 223
BssT1I CCWWGG 1 cut(s) 11
Bst2UI CCWGG 1 cut(s) 137
Bst6I CTCTTC 1 cut(s) 225
BstF5I GGATG 2 cut(s) 32, 84
BstKTI GATC 1 cut(s) 226
BstMBI GATC 1 cut(s) 223
BstNI CCWGG 1 cut(s) 137
BstSCI CCNGG 1 cut(s) 135
BstSFI CTRYAG 1 cut(s) 66
BsuRI GGCC 1 cut(s) 16
BtsCI GGATG 2 cut(s) 32, 84
CaiI CAGNNNCTG 1 cut(s) 136
CviJI RGCY 3 cut(s) 16, 27, 170
CviKI_1 RGCY 3 cut(s) 16, 27, 170
DpnI GATC 1 cut(s) 225
DpnII GATC 1 cut(s) 223
EaeI YGGCCR 1 cut(s) 14
Eam1104I CTCTTC 1 cut(s) 225
EarI CTCTTC 1 cut(s) 225
Ecl136II GAGCTC 1 cut(s) 27
Eco130I CCWWGG 1 cut(s) 11
Eco24I GRGCYC 1 cut(s) 29
Eco53kI GAGCTC 1 cut(s) 27
EcoICRI GAGCTC 1 cut(s) 27
EcoRII CCWGG 1 cut(s) 135
EcoT14I CCWWGG 1 cut(s) 11
EcoT38I GRGCYC 1 cut(s) 29
ErhI CCWWGG 1 cut(s) 11
FaiI YATR 4 cut(s) 77, 155, 237, 239
FauNDI CATATG 1 cut(s) 237
FbaI TGATCA 1 cut(s) 223
FokI GGATG 2 cut(s) 19, 71
FriOI GRGCYC 1 cut(s) 29
FspBI CTAG 1 cut(s) 213
HaeIII GGCC 1 cut(s) 16
HapII CCGG 1 cut(s) 88
HinfI GANTC 1 cut(s) 186
HpaII CCGG 1 cut(s) 88
Hpy188I TCNGA 2 cut(s) 94, 132
Hpy188III TCNNGA 1 cut(s) 227
HpyCH4V TGCA 2 cut(s) 32, 146
Ksp22I TGATCA 1 cut(s) 223
Kzo9I GATC 1 cut(s) 223
LguI GCTCTTC 1 cut(s) 225
LpnPI CCDG 6 cut(s) 100, 101, 122, 149, 149, 234
LweI GCATC 2 cut(s) 41, 93
MaeI CTAG 1 cut(s) 213
MaeIII GTNAC 1 cut(s) 96
MalI GATC 1 cut(s) 225
MboI GATC 1 cut(s) 223
MboII GAAGA 1 cut(s) 242
MfeI CAATTG 1 cut(s) 39
MhlI GDGCHC 1 cut(s) 29
MlsI TGGCCA 1 cut(s) 16
MluCI AATT 1 cut(s) 39
MluNI TGGCCA 1 cut(s) 16
MnlI CCTC 3 cut(s) 115, 169, 201
Mox20I TGGCCA 1 cut(s) 16
MscI TGGCCA 1 cut(s) 16
MseI TTAA 2 cut(s) 182, 203
MslI CAYNNNNRTG 1 cut(s) 105
Msp20I TGGCCA 1 cut(s) 16
MspI CCGG 1 cut(s) 88
MspR9I CCNGG 1 cut(s) 137
MunI CAATTG 1 cut(s) 39
Mva1269I GAATGC 1 cut(s) 60
MvaI CCWGG 1 cut(s) 137
NdeI CATATG 1 cut(s) 237
NdeII GATC 1 cut(s) 223
PciSI GCTCTTC 1 cut(s) 225
PctI GAATGC 1 cut(s) 60
PfeI GAWTC 1 cut(s) 186
Psp124BI GAGCTC 1 cut(s) 29
Psp6I CCWGG 1 cut(s) 135
PspGI CCWGG 1 cut(s) 135
PstNI CAGNNNCTG 1 cut(s) 136
RseI CAYNNNNRTG 1 cut(s) 105
SacI GAGCTC 1 cut(s) 29
SapI GCTCTTC 1 cut(s) 225
SaqAI TTAA 2 cut(s) 182, 203
Sau3AI GATC 1 cut(s) 223
ScrFI CCNGG 1 cut(s) 137
SduI GDGCHC 1 cut(s) 29
SetI ASST 4 cut(s) 13, 29, 161, 223
SfaNI GCATC 2 cut(s) 41, 93
SfcI CTRYAG 1 cut(s) 66
SmiMI CAYNNNNRTG 1 cut(s) 105
Sse9I AATT 1 cut(s) 39
SsiI CCGC 1 cut(s) 36
SspMI CTAG 1 cut(s) 213
SstI GAGCTC 1 cut(s) 29
StyD4I CCNGG 1 cut(s) 135
StyI CCWWGG 1 cut(s) 11
TasI AATT 1 cut(s) 39
TfiI GAWTC 1 cut(s) 186
Tru1I TTAA 2 cut(s) 182, 203
Tru9I TTAA 2 cut(s) 182, 203
TspGWI ACGGA 1 cut(s) 183
XspI CTAG 1 cut(s) 213
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.