Rroxscaffold_1G00015510

No description available

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000001
Physical Location & Seq
Reverse (-)
19290780 .. 19291784
1005 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_1G00015510.1

Sequence Viewer

Length: 252 bp
ATGGGGGACCTCCCTCCGAAAACCTATGCTCTCCCTCTCTCTCGGGTATCTCTTCATCGTTGTTGTCTCTCTCTCTCTCTCTCTCTCTCTCTCGACGGCACCGACACTCTCCCTCTCCCCTCGACGGTCGACGACGCTCGCTCTTCTCGACAAGTGACGGCTAAGTCCCTCTCTCAAATCAAGAACTTGATCAATTCCTCTCTCTCGATTCGATCAATAGCATTCGGGTTTTTAATTCTTGTTCTTTTGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

83

Amino Acids

8.93

Weight (kDa)

9.3

Isoelectric Point (pI)

48.21

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 163
AccB1I GGYRCC 1 cut(s) 98
AccI GTMKAC 1 cut(s) 129
AfiI CCNNNNNNNGG 1 cut(s) 124
Alw26I GTCTC 1 cut(s) 71
Ama87I CYCGRG 1 cut(s) 42
AspS9I GGNCC 1 cut(s) 7
AvaI CYCGRG 1 cut(s) 42
AvaII GGWCC 1 cut(s) 7
BanI GGYRCC 1 cut(s) 98
BceAI ACGGC 2 cut(s) 112, 174
BclI TGATCA 1 cut(s) 189
BcoDI GTCTC 1 cut(s) 71
Bme18I GGWCC 1 cut(s) 7
BmeT110I CYCGRG 1 cut(s) 42
BmgT120I GGNCC 1 cut(s) 7
BmiI GGNNCC 2 cut(s) 8, 100
Bsc4I CCNNNNNNNGG 1 cut(s) 124
BseLI CCNNNNNNNGG 1 cut(s) 124
Bsh1285I CGRYCG 1 cut(s) 129
BshNI GGYRCC 1 cut(s) 98
BsiEI CGRYCG 1 cut(s) 129
BsiHKCI CYCGRG 1 cut(s) 42
BslFI GGGAC 2 cut(s) 20, 151
BslI CCNNNNNNNGG 1 cut(s) 124
BsmAI GTCTC 1 cut(s) 71
BsmFI GGGAC 2 cut(s) 20, 151
BsmI GAATGC 1 cut(s) 221
BsoBI CYCGRG 1 cut(s) 42
Bsp143I GATC 2 cut(s) 189, 212
BspLI GGNNCC 2 cut(s) 8, 100
BspQI GCTCTTC 1 cut(s) 148
BspT107I GGYRCC 1 cut(s) 98
BssMI GATC 2 cut(s) 189, 212
Bst4CI ACNGT 1 cut(s) 127
Bst6I CTCTTC 2 cut(s) 57, 148
BstC8I GCNNGC 1 cut(s) 139
BstDEI CTNAG 1 cut(s) 162
BstKTI GATC 2 cut(s) 192, 215
BstMAI GTCTC 1 cut(s) 71
BstMBI GATC 2 cut(s) 189, 212
BstMCI CGRYCG 1 cut(s) 129
Cac8I GCNNGC 1 cut(s) 139
Cfr13I GGNCC 1 cut(s) 7
CseI GACGC 1 cut(s) 143
CviJI RGCY 1 cut(s) 161
CviKI_1 RGCY 1 cut(s) 161
DdeI CTNAG 1 cut(s) 162
DpnI GATC 2 cut(s) 191, 214
DpnII GATC 2 cut(s) 189, 212
DrdI GACNNNNNNGTC 1 cut(s) 163
DseDI GACNNNNNNGTC 1 cut(s) 163
Eam1104I CTCTTC 2 cut(s) 57, 148
EarI CTCTTC 2 cut(s) 57, 148
Eco47I GGWCC 1 cut(s) 7
Eco88I CYCGRG 1 cut(s) 42
EcoO109I RGGNCCY 1 cut(s) 7
FaiI YATR 1 cut(s) 27
FaqI GGGAC 2 cut(s) 20, 151
FbaI TGATCA 1 cut(s) 189
FblI GTMKAC 1 cut(s) 129
HgaI GACGC 1 cut(s) 143
HincII GTYRAC 1 cut(s) 130
HindII GTYRAC 1 cut(s) 130
HinfI GANTC 1 cut(s) 208
Hpy166II GTNNAC 1 cut(s) 130
Hpy188I TCNGA 1 cut(s) 18
Hpy188III TCNNGA 4 cut(s) 92, 147, 181, 205
Hpy8I GTNNAC 1 cut(s) 130
Hpy99I CGWCG 4 cut(s) 98, 127, 134, 137
HpyCH4III ACNGT 1 cut(s) 127
HpyF3I CTNAG 1 cut(s) 162
Ksp22I TGATCA 1 cut(s) 189
Kzo9I GATC 2 cut(s) 189, 212
LguI GCTCTTC 1 cut(s) 148
MaeIII GTNAC 1 cut(s) 154
MalI GATC 2 cut(s) 191, 214
MboI GATC 2 cut(s) 189, 212
MboII GAAGA 2 cut(s) 44, 135
MluCI AATT 2 cut(s) 193, 234
MnlI CCTC 7 cut(s) 20, 24, 45, 123, 130, 179, 208
MseI TTAA 1 cut(s) 233
Mva1269I GAATGC 1 cut(s) 221
NdeII GATC 2 cut(s) 189, 212
NlaIV GGNNCC 2 cut(s) 8, 100
NmuCI GTSAC 1 cut(s) 154
PciSI GCTCTTC 1 cut(s) 148
PcsI WCGNNNNNNNCGW 2 cut(s) 99, 145
PctI GAATGC 1 cut(s) 221
PfeI GAWTC 1 cut(s) 208
PpuMI RGGWCCY 1 cut(s) 7
Psp5II RGGWCCY 1 cut(s) 7
PspN4I GGNNCC 2 cut(s) 8, 100
PspPI GGNCC 1 cut(s) 7
PspPPI RGGWCCY 1 cut(s) 7
SalI GTCGAC 1 cut(s) 128
SapI GCTCTTC 1 cut(s) 148
SaqAI TTAA 1 cut(s) 233
Sau3AI GATC 2 cut(s) 189, 212
Sau96I GGNCC 1 cut(s) 7
SetI ASST 2 cut(s) 12, 26
SinI GGWCC 1 cut(s) 7
Sse9I AATT 2 cut(s) 193, 234
TaaI ACNGT 1 cut(s) 127
TaqI TCGA 6 cut(s) 93, 122, 129, 148, 206, 211
TasI AATT 2 cut(s) 193, 234
TfiI GAWTC 1 cut(s) 208
Tru1I TTAA 1 cut(s) 233
Tru9I TTAA 1 cut(s) 233
TseFI GTSAC 1 cut(s) 154
Tsp45I GTSAC 1 cut(s) 154
TspDTI ATGAA 1 cut(s) 44
VpaK11BI GGWCC 1 cut(s) 7
XmiI GTMKAC 1 cut(s) 129
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.