Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_co8452039.1

Orthogroup ID

OG0004169

Physical Location & Seq

Genomic Coordinates Forward (+)

1 .. 1386

Gene Structure 1386 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_co8452039.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 455 bp

tctttagagaccctggttctgttccagaaaattggaaacctcgtacacaggaggaaattttggaggctggtagttctctaacttcgacggaaatcacagcacccgaggttttcaattccacgcagtctacagatggacaagaaagaagaccagaagtaggctattgtagtcggtgccaaaatgccaagccaccacgatgccatcattgctctgtgtgtcaaagatgtgtacttaagatggatcaccattgtgtttgggtggtgaattgtgttggtgccaccaactacaagtcttttctgcttttcttgctttatacatttttggagacgacaatggacaccttagttttgctgccgaatttcatcaattttttttctgaagccaagagtcattccacatctcctggcaatctagcagttgtttttgtgacttttggtaggagtccacatagatga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

DHHC

Protein Analysis

150

Amino Acids

16.93

Weight (kDa)

7.13

Isoelectric Point (pI)

39.57

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0004169)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT4G00840 AT4G00840
fragaria_vesca	FvH4_7g17410 FvH4_7g17410 FvH4_7g17410 FvH4_7g17410 FvH4_7g17410 FvH4_7g17410 FvH4_7g17410 FvH4_7g17410
malus_domestica	MD01G1087100.v1.1 MD07G1157300.v1.1
prunus_persica	Prupe.2G195700_v2.0.a1 Prupe.2G195700_v2.0.a1 Prupe.2G195700_v2.0.a1
pyrus_communis	pycom01g11100 pycom07g15370 pycom07g15390
rosa_chinensis	RchiOBHm_Chr1g0360851
rosa_laevigata	RLG00000027781
rosa_multiflora	Rmu_co8452039.1_g000001 Rmu_ssc0000022.1_g000048
rosa_roxburghii	Rroxscaffold_4G00295760
rosa_rugosa	Rorug01G0282300 Rorug01G0282300 Rorug01G0282300 Rorug01G0282300 Rorug01G0282300
rosa_samantha	Rh1AG294000 Rh1BG258800 Rh1CG276400 Rh1DG289000
rosa_wichuraiana	Rw1G026020

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB1I	GGYRCC	2 cut(s)	173, 274
AccI	GTMKAC	1 cut(s)	127
AclWI	GGATC	1 cut(s)	248
AcsI	RAATTY	2 cut(s)	56, 357
AcuI	CTGAAG	1 cut(s)	398
AfaI	GTAC	2 cut(s)	45, 230
AfiI	CCNNNNNNNGG	1 cut(s)	157
AflII	CTTAAG	1 cut(s)	232
AgsI	TTSAA	1 cut(s)	114
AjnI	CCWGG	2 cut(s)	12, 402
AleI	CACNNNNGTG	1 cut(s)	248
Alw26I	GTCTC	2 cut(s)	2, 319
AlwI	GGATC	1 cut(s)	248
Ama87I	CYCGRG	1 cut(s)	103
ApeKI	GCWGC	1 cut(s)	351
ApoI	RAATTY	2 cut(s)	56, 357
AsuHPI	GGTGA	2 cut(s)	235, 273
AvaI	CYCGRG	1 cut(s)	103
BanI	GGYRCC	2 cut(s)	173, 274
BbsI	GAAGAC	1 cut(s)	153
BbvI	GCAGC	1 cut(s)	338
BccI	CCATC	3 cut(s)	127, 209, 231
BciT130I	CCWGG	2 cut(s)	14, 404
BcoDI	GTCTC	2 cut(s)	2, 319
BfaI	CTAG	1 cut(s)	412
BfmI	CTRYAG	1 cut(s)	128
BfrI	CTTAAG	1 cut(s)	232
BisI	GCNGC	1 cut(s)	352
BlsI	GCNGC	1 cut(s)	353
Bme1390I	CCNGG	2 cut(s)	14, 404
BmeT110I	CYCGRG	1 cut(s)	103
BmiI	GGNNCC	2 cut(s)	175, 276
BmrFI	CCNGG	2 cut(s)	14, 404
BmsI	GCATC	1 cut(s)	187
BpiI	GAAGAC	1 cut(s)	153
BsaI	GGTCTC	1 cut(s)	2
BsaJI	CCNNGG	2 cut(s)	12, 104
Bsc4I	CCNNNNNNNGG	1 cut(s)	157
Bse3DI	GCAATG	1 cut(s)	204
BseBI	CCWGG	2 cut(s)	14, 404
BseDI	CCNNGG	2 cut(s)	12, 104
BseLI	CCNNNNNNNGG	1 cut(s)	157
BseMI	GCAATG	1 cut(s)	204
BseXI	GCAGC	1 cut(s)	338
BshNI	GGYRCC	2 cut(s)	173, 274
BsiHKCI	CYCGRG	1 cut(s)	103
BslI	CCNNNNNNNGG	1 cut(s)	157
BsmAI	GTCTC	2 cut(s)	2, 319
BsmBI	CGTCTC	1 cut(s)	319
Bso31I	GGTCTC	1 cut(s)	2
BsoBI	CYCGRG	1 cut(s)	103
Bsp143I	GATC	1 cut(s)	240
BspLI	GGNNCC	2 cut(s)	175, 276
BspPI	GGATC	1 cut(s)	248
BspT107I	GGYRCC	2 cut(s)	173, 274
BspTI	CTTAAG	1 cut(s)	232
BspTNI	GGTCTC	1 cut(s)	2
BsrDI	GCAATG	1 cut(s)	204
BssECI	CCNNGG	2 cut(s)	12, 104
BssMI	GATC	1 cut(s)	240
Bst2UI	CCWGG	2 cut(s)	14, 404
BstAFI	CTTAAG	1 cut(s)	232
BstDEI	CTNAG	1 cut(s)	342
BstKTI	GATC	1 cut(s)	243
BstMAI	GTCTC	2 cut(s)	2, 319
BstMBI	GATC	1 cut(s)	240
BstMWI	GCNNNNNNNGC	2 cut(s)	206, 306
BstNI	CCWGG	2 cut(s)	14, 404
BstSCI	CCNGG	2 cut(s)	12, 402
BstSFI	CTRYAG	1 cut(s)	128
BstV1I	GCAGC	1 cut(s)	338
BstV2I	GAAGAC	1 cut(s)	153
BstXI	CCANNNNNNTGG	1 cut(s)	32
Csp6I	GTAC	2 cut(s)	44, 229
CviJI	RGCY	4 cut(s)	67, 161, 189, 382
CviKI_1	RGCY	4 cut(s)	67, 161, 189, 382
CviQI	GTAC	2 cut(s)	44, 229
DdeI	CTNAG	1 cut(s)	342
DpnI	GATC	1 cut(s)	242
DpnII	GATC	1 cut(s)	240
Eco31I	GGTCTC	1 cut(s)	2
Eco57I	CTGAAG	1 cut(s)	398
Eco88I	CYCGRG	1 cut(s)	103
EcoRII	CCWGG	2 cut(s)	12, 402
Esp3I	CGTCTC	1 cut(s)	319
FaiI	YATR	2 cut(s)	314, 449
FblI	GTMKAC	1 cut(s)	127
Fnu4HI	GCNGC	1 cut(s)	352
Fsp4HI	GCNGC	1 cut(s)	352
FspBI	CTAG	1 cut(s)	412
GluI	GCNGC	1 cut(s)	352
HinfI	GANTC	2 cut(s)	387, 441
HphI	GGTGA	2 cut(s)	235, 273
Hpy166II	GTNNAC	4 cut(s)	46, 128, 229, 445
Hpy188I	TCNGA	1 cut(s)	378
Hpy188III	TCNNGA	1 cut(s)	25
Hpy8I	GTNNAC	4 cut(s)	46, 128, 229, 445
Hpy99I	CGWCG	1 cut(s)	90
HpyF10VI	GCNNNNNNNGC	2 cut(s)	206, 306
HpyF3I	CTNAG	1 cut(s)	342
Kzo9I	GATC	1 cut(s)	240
LpnPI	CCDG	7 cut(s)	26, 34, 38, 53, 164, 389, 416
Lsp1109I	GCAGC	1 cut(s)	338
LweI	GCATC	1 cut(s)	187
MaeI	CTAG	1 cut(s)	412
MaeIII	GTNAC	1 cut(s)	426
MalI	GATC	1 cut(s)	242
MboI	GATC	1 cut(s)	240
MboII	GAAGA	1 cut(s)	158
MluCI	AATT	6 cut(s)	30, 56, 114, 264, 357, 366
MlyI	GAGTC	2 cut(s)	396, 450
MnlI	CCTC	4 cut(s)	45, 50, 57, 99
MseI	TTAA	1 cut(s)	233
MslI	CAYNNNNRTG	3 cut(s)	195, 248, 450
MspCI	CTTAAG	1 cut(s)	232
MspR9I	CCNGG	2 cut(s)	14, 404
MvaI	CCWGG	2 cut(s)	14, 404
MwoI	GCNNNNNNNGC	2 cut(s)	206, 306
NdeII	GATC	1 cut(s)	240
NlaIV	GGNNCC	2 cut(s)	175, 276
NmuCI	GTSAC	1 cut(s)	426
OliI	CACNNNNGTG	1 cut(s)	248
PkrI	GCNGC	1 cut(s)	353
PleI	GAGTC	2 cut(s)	395, 449
PpsI	GAGTC	2 cut(s)	395, 449
Psp6I	CCWGG	2 cut(s)	12, 402
PspGI	CCWGG	2 cut(s)	12, 402
PspN4I	GGNNCC	2 cut(s)	175, 276
RsaI	GTAC	2 cut(s)	45, 230
RsaNI	GTAC	2 cut(s)	44, 229
RseI	CAYNNNNRTG	3 cut(s)	195, 248, 450
SaqAI	TTAA	1 cut(s)	233
SatI	GCNGC	1 cut(s)	352
Sau3AI	GATC	1 cut(s)	240
SchI	GAGTC	2 cut(s)	396, 450
ScrFI	CCNGG	2 cut(s)	14, 404
SetI	ASST	3 cut(s)	42, 110, 343
SfaNI	GCATC	1 cut(s)	187
SfcI	CTRYAG	1 cut(s)	128
SmiMI	CAYNNNNRTG	3 cut(s)	195, 248, 450
SmlI	CTYRAG	1 cut(s)	232
SmoI	CTYRAG	1 cut(s)	232
Sse9I	AATT	6 cut(s)	30, 56, 114, 264, 357, 366
SspMI	CTAG	1 cut(s)	412
StyD4I	CCNGG	2 cut(s)	12, 402
TaqI	TCGA	1 cut(s)	85
TasI	AATT	6 cut(s)	30, 56, 114, 264, 357, 366
TatI	WGTACW	1 cut(s)	228
Tru1I	TTAA	1 cut(s)	233
Tru9I	TTAA	1 cut(s)	233
TseFI	GTSAC	1 cut(s)	426
TseI	GCWGC	1 cut(s)	351
Tsp45I	GTSAC	1 cut(s)	426
TspDTI	ATGAA	1 cut(s)	351
TspGWI	ACGGA	1 cut(s)	103
Vha464I	CTTAAG	1 cut(s)	232
XapI	RAATTY	2 cut(s)	56, 357
XmiI	GTMKAC	1 cut(s)	127
XspI	CTAG	1 cut(s)	412

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.