Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_co8463891.1

Orthogroup ID

OG0002885

Physical Location & Seq

Genomic Coordinates Reverse (-)

2 .. 1846

Gene Structure 1845 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_co8463891.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 783 bp

atgtgccataaggctgcaaagtttcaatgcttttgctgcccacaagctgtatgcggacgctgcctctgtgactctgagtttgcagttattaaagtggatagaggattttgcaatcattgcttgaagcttgctgtactcatagaagaaaacttggatgctgattctgacgggggcagagttgacttcaaagatataaacacatttgagtacttatttaaggagtattggcaggtaatgaaaaagaaagaacgcttgtctgcagaacatgtctactctgcgaaaaagttattaaagaagggaaagaactacgtgcgtgactttgattcgagtataatttgtaagaaagatgaaaaattttcagaatccgatgaagaaagtgaccttcaggtgtctgattatgatggagtggaaagtggagaagaatacatgccagttgccaaaaagaagagatccaagggaaaacagtgttcagtgaaaagaaaagtagaagcagagaaacgagaatttatgggatggggatcaaagtctctcctagaatttcttgcttctatgggtaaagatacatccaaggagttgtcacagtatgaagtcacctctgtggttacagactattgtaaagaaaacaagctttttgacccagaaaagaagaagaaagtaatttgcgatgcaaccttgcagtctcttttagggaggaaaacattgaataaaaatagcatatataaccttctgacttcccattttgctgacaatctggaagagtcaacggagggggatgagagtgga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

GYF Plus-3 SWIB

Protein Analysis

261

Amino Acids

29.8

Weight (kDa)

6.48

Isoelectric Point (pI)

39.04

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0002885)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT5G63700 AT5G63700
fragaria_vesca	FvH4_2g12310 FvH4_2g12310 FvH4_2g12310 FvH4_2g12310 FvH4_2g12310 FvH4_2g12310
malus_domestica	MD15G1440700.v1.1
prunus_persica	Prupe.1G582800_v2.0.a1 Prupe.1G582800_v2.0.a1 Prupe.1G582800_v2.0.a1 Prupe.1G582800_v2.0.a1 Prupe.1G582800_v2.0.a1 Prupe.1G582800_v2.0.a1 Prupe.1G582800_v2.0.a1 Prupe.1G582800_v2.0.a1 Prupe.1G582800_v2.0.a1 Prupe.1G582800_v2.0.a1 Prupe.1G582800_v2.0.a1 Prupe.1G582800_v2.0.a1 Prupe.1G582800_v2.0.a1 Prupe.1G582800_v2.0.a1 Prupe.1G582800_v2.0.a1
pyrus_communis	pycom15g38850
rosa_chinensis	RchiOBHm_Chr6g0272281 RchiOBHm_Chr6g0272291
rosa_laevigata	RLG00000013684 RLG00000013685
rosa_multiflora	Rmu_co8463891.1_g000001 Rmu_sc0004424.1_g000005
rosa_roxburghii	Rroxscaffold_7G00196450
rosa_rugosa	Rorug06G0067400
rosa_samantha	Rh6AG184100 Rh6BG187300 Rh6CG185600 Rh6DG177400
rosa_wichuraiana	Rw6G015880

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
Acc36I	ACCTGC	1 cut(s)	220
AccI	GTMKAC	1 cut(s)	270
AciI	CCGC	1 cut(s)	54
AclWI	GGATC	2 cut(s)	444, 526
AcsI	RAATTY	3 cut(s)	353, 503, 536
AcuI	CTGAAG	1 cut(s)	368
AfaI	GTAC	2 cut(s)	135, 209
AflIII	ACRYGT	1 cut(s)	265
AgsI	TTSAA	4 cut(s)	26, 124, 187, 703
AleI	CACNNNNGTG	1 cut(s)	596
AluBI	AGCT	3 cut(s)	47, 127, 628
AluI	AGCT	3 cut(s)	47, 127, 628
Alw26I	GTCTC	2 cut(s)	531, 684
AlwI	GGATC	2 cut(s)	444, 526
ApeKI	GCWGC	3 cut(s)	14, 36, 60
ApoI	RAATTY	3 cut(s)	353, 503, 536
ArsI	GACNNNNNNTTYG	2 cut(s)	62, 94
AsuHPI	GGTGA	1 cut(s)	583
BbvI	GCAGC	2 cut(s)	23, 47
BccI	CCATC	2 cut(s)	395, 507
BcoDI	GTCTC	2 cut(s)	531, 684
BfaI	CTAG	1 cut(s)	533
BfmI	CTRYAG	1 cut(s)	258
BfuAI	ACCTGC	1 cut(s)	220
BisI	GCNGC	3 cut(s)	15, 37, 61
BlsI	GCNGC	3 cut(s)	16, 38, 62
BmcAI	AGTACT	1 cut(s)	209
BmsI	GCATC	2 cut(s)	145, 655
BsaAI	YACGTR	1 cut(s)	310
BsaBI	GATNNNNATC	1 cut(s)	517
BsaJI	CCNNGG	2 cut(s)	453, 567
Bse1I	ACTGG	1 cut(s)	431
Bse3DI	GCAATG	1 cut(s)	115
Bse8I	GATNNNNATC	1 cut(s)	517
BseDI	CCNNGG	2 cut(s)	453, 567
BseGI	GGATG	4 cut(s)	160, 518, 563, 778
BseJI	GATNNNNATC	1 cut(s)	517
BseMI	GCAATG	1 cut(s)	115
BseMII	CTCAG	1 cut(s)	66
BseNI	ACTGG	1 cut(s)	431
BseXI	GCAGC	2 cut(s)	23, 47
BsmAI	GTCTC	2 cut(s)	531, 684
Bsp143I	GATC	2 cut(s)	449, 518
BspACI	CCGC	1 cut(s)	54
BspCNI	CTCAG	1 cut(s)	67
BspMAI	CTGCAG	1 cut(s)	262
BspMI	ACCTGC	1 cut(s)	220
BspPI	GGATC	2 cut(s)	444, 526
BsrDI	GCAATG	1 cut(s)	115
BsrI	ACTGG	1 cut(s)	431
BssECI	CCNNGG	2 cut(s)	453, 567
BssMI	GATC	2 cut(s)	449, 518
BssT1I	CCWWGG	2 cut(s)	453, 567
Bst4CI	ACNGT	2 cut(s)	465, 582
Bst6I	CTCTTC	2 cut(s)	440, 750
BstAPI	GCANNNNNTGC	1 cut(s)	117
BstBAI	YACGTR	1 cut(s)	310
BstC8I	GCNNGC	1 cut(s)	129
BstDEI	CTNAG	1 cut(s)	75
BstF5I	GGATG	4 cut(s)	160, 518, 563, 778
BstKTI	GATC	2 cut(s)	452, 521
BstMAI	GTCTC	2 cut(s)	531, 684
BstMBI	GATC	2 cut(s)	449, 518
BstMWI	GCNNNNNNNGC	3 cut(s)	36, 60, 117
BstNSI	RCATGY	2 cut(s)	269, 430
BstSFI	CTRYAG	1 cut(s)	258
BstV1I	GCAGC	2 cut(s)	23, 47
BstX2I	RGATCY	1 cut(s)	449
BstYI	RGATCY	1 cut(s)	449
BtgZI	GCGATG	1 cut(s)	678
BtsCI	GGATG	4 cut(s)	160, 518, 563, 778
BtsIMutI	CAGTG	2 cut(s)	470, 477
BveI	ACCTGC	1 cut(s)	220
Cac8I	GCNNGC	1 cut(s)	129
CseI	GACGC	1 cut(s)	66
Csp6I	GTAC	2 cut(s)	134, 208
CviAII	CATG	2 cut(s)	266, 427
CviJI	RGCY	4 cut(s)	14, 47, 127, 628
CviKI_1	RGCY	4 cut(s)	14, 47, 127, 628
CviQI	GTAC	2 cut(s)	134, 208
DdeI	CTNAG	1 cut(s)	75
DpnI	GATC	2 cut(s)	451, 520
DpnII	GATC	2 cut(s)	449, 518
Eam1104I	CTCTTC	2 cut(s)	440, 750
EarI	CTCTTC	2 cut(s)	440, 750
Eco130I	CCWWGG	2 cut(s)	453, 567
Eco57I	CTGAAG	1 cut(s)	368
EcoT14I	CCWWGG	2 cut(s)	453, 567
ErhI	CCWWGG	2 cut(s)	453, 567
FaeI	CATG	2 cut(s)	269, 430
FatI	CATG	2 cut(s)	265, 426
FblI	GTMKAC	1 cut(s)	270
Fnu4HI	GCNGC	3 cut(s)	15, 37, 61
FokI	GGATG	3 cut(s)	167, 525, 550
Fsp4HI	GCNGC	3 cut(s)	15, 37, 61
FspBI	CTAG	1 cut(s)	533
GluI	GCNGC	3 cut(s)	15, 37, 61
HgaI	GACGC	1 cut(s)	66
Hin1II	CATG	2 cut(s)	269, 430
HincII	GTYRAC	2 cut(s)	181, 762
HindII	GTYRAC	2 cut(s)	181, 762
HindIII	AAGCTT	2 cut(s)	125, 626
HinfI	GANTC	5 cut(s)	71, 161, 323, 362, 758
HphI	GGTGA	1 cut(s)	583
Hpy166II	GTNNAC	3 cut(s)	181, 271, 762
Hpy188I	TCNGA	6 cut(s)	76, 166, 361, 367, 394, 729
Hpy188III	TCNNGA	1 cut(s)	752
Hpy8I	GTNNAC	3 cut(s)	181, 271, 762
HpyAV	CCTTC	3 cut(s)	289, 392, 734
HpyCH4III	ACNGT	2 cut(s)	465, 582
HpyCH4IV	ACGT	1 cut(s)	309
HpyCH4V	TGCA	6 cut(s)	17, 83, 111, 260, 668, 676
HpyF10VI	GCNNNNNNNGC	3 cut(s)	36, 60, 117
HpyF3I	CTNAG	1 cut(s)	75
HpySE526I	ACGT	1 cut(s)	309
Hsp92II	CATG	2 cut(s)	269, 430
Kzo9I	GATC	2 cut(s)	449, 518
LpnPI	CCDG	5 cut(s)	215, 371, 444, 651, 737
Lsp1109I	GCAGC	2 cut(s)	23, 47
LweI	GCATC	2 cut(s)	145, 655
MaeI	CTAG	1 cut(s)	533
MaeII	ACGT	1 cut(s)	309
MaeIII	GTNAC	6 cut(s)	68, 314, 377, 576, 589, 601
MalI	GATC	2 cut(s)	451, 520
MboI	GATC	2 cut(s)	449, 518
MboII	GAAGA	7 cut(s)	155, 383, 431, 457, 658, 661, 767
MflI	RGATCY	1 cut(s)	449
MluCI	AATT	5 cut(s)	333, 353, 503, 536, 657
MlyI	GAGTC	2 cut(s)	65, 767
MnlI	CCTC	5 cut(s)	74, 95, 604, 684, 760
MseI	TTAA	3 cut(s)	90, 216, 290
MslI	CAYNNNNRTG	1 cut(s)	596
MwoI	GCNNNNNNNGC	3 cut(s)	36, 60, 117
NdeII	GATC	2 cut(s)	449, 518
NlaIII	CATG	2 cut(s)	269, 430
NmuCI	GTSAC	5 cut(s)	68, 314, 377, 576, 589
NspI	RCATGY	2 cut(s)	269, 430
OliI	CACNNNNGTG	1 cut(s)	596
PciI	ACATGT	1 cut(s)	265
PfeI	GAWTC	3 cut(s)	161, 323, 362
PkrI	GCNGC	3 cut(s)	16, 38, 62
PleI	GAGTC	2 cut(s)	65, 766
PpsI	GAGTC	2 cut(s)	65, 766
Ppu21I	YACGTR	1 cut(s)	310
PscI	ACATGT	1 cut(s)	265
PstI	CTGCAG	1 cut(s)	262
PsuI	RGATCY	1 cut(s)	449
RsaI	GTAC	2 cut(s)	135, 209
RsaNI	GTAC	2 cut(s)	134, 208
RseI	CAYNNNNRTG	1 cut(s)	596
SaqAI	TTAA	3 cut(s)	90, 216, 290
SatI	GCNGC	3 cut(s)	15, 37, 61
Sau3AI	GATC	2 cut(s)	449, 518
ScaI	AGTACT	1 cut(s)	209
SchI	GAGTC	2 cut(s)	65, 767
SfaNI	GCATC	2 cut(s)	145, 655
SfcI	CTRYAG	1 cut(s)	258
SmiMI	CAYNNNNRTG	1 cut(s)	596
Sse9I	AATT	5 cut(s)	333, 353, 503, 536, 657
SsiI	CCGC	1 cut(s)	54
SspMI	CTAG	1 cut(s)	533
StyI	CCWWGG	2 cut(s)	453, 567
TaaI	ACNGT	2 cut(s)	465, 582
TaiI	ACGT	1 cut(s)	312
TaqI	TCGA	1 cut(s)	326
TasI	AATT	5 cut(s)	333, 353, 503, 536, 657
TatI	WGTACW	2 cut(s)	133, 207
TfiI	GAWTC	3 cut(s)	161, 323, 362
Tru1I	TTAA	3 cut(s)	90, 216, 290
Tru9I	TTAA	3 cut(s)	90, 216, 290
TscAI	CASTG	2 cut(s)	470, 477
TseFI	GTSAC	5 cut(s)	68, 314, 377, 576, 589
TseI	GCWGC	3 cut(s)	14, 36, 60
Tsp45I	GTSAC	5 cut(s)	68, 314, 377, 576, 589
TspDTI	ATGAA	4 cut(s)	251, 363, 384, 600
TspGWI	ACGGA	1 cut(s)	779
TspRI	CASTG	2 cut(s)	470, 477
XapI	RAATTY	3 cut(s)	353, 503, 536
XceI	RCATGY	2 cut(s)	269, 430
XmiI	GTMKAC	1 cut(s)	270
XspI	CTAG	1 cut(s)	533
ZrmI	AGTACT	1 cut(s)	209

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.