Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_co8463975.1

Orthogroup ID

OG0005318

Physical Location & Seq

Genomic Coordinates Forward (+)

73 .. 1787

Gene Structure 1715 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_co8463975.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 831 bp

atgcagagacatgttctctccctcgatggacctgtggtgactgcatcaggcttcatggatgagcttgccattgtcactcatgcttcagacagtcttccctcaaatgaacaggtgcttgaatttagggtacttaacataaataatagtagccagcctcttagaggacgtctgcctctgactcctggttcaagtttaacatggtttggctttagtgaagaagggaaattaagctcctatgactccaagggtgtgctgagagtttttacaagtgaatatggtggcagttgtaaatatctgattggcagtgctagtaaagacaagaagtcagatgaaaactattgggtgatcggtttgaatgcaagacaactattttgtatagtttgcaaaagccccgagttatatccacaggtgttgcccaaaccagtgctcactctactaaatttttcaattcctcttgcatcctctgatctaggagcagaagcccttgaaaatgcatttatactaaacgacatgcatctcgtacagattcaaaagcaaatagaagaaatggatgctgtaggtttagacaccagttcacttgatgatgaagcttttaaattggaaacagctcaagatcaatgtatattgaggcttattggatcctgctgccatggagataagcttgtgagggctactgaacttgtgaagcatctatccctggaaaaatcagttaggggtgcaattaagattgttacttctctgaagctacctaacttggctgaaaggttcaatagcatattggaggtttcttatgctcttggccttcaaacaggaaaggttgctcaacgatag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Mcl1_mid WD40

Protein Analysis

276

Amino Acids

30.29

Weight (kDa)

5.61

Isoelectric Point (pI)

36.12

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0005318)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT3G42660
fragaria_vesca	FvH4_5g13280 FvH4_5g13280 FvH4_5g13280 FvH4_5g13280 FvH4_5g13280
malus_domestica	MD06G1206600.v1.1 MD14G1217300.v1.1
prunus_persica	Prupe.5G211000_v2.0.a1 Prupe.5G211000_v2.0.a1 Prupe.5G211000_v2.0.a1 Prupe.5G211000_v2.0.a1 Prupe.5G211000_v2.0.a1
pyrus_communis	pycom06g18450 pycom14g18000
rosa_chinensis	RchiOBHm_Chr7g0183891
rosa_laevigata	RLG00000005014
rosa_multiflora	Rmu_co8106328.1_g000001 Rmu_co8463975.1_g000001 Rmu_sc0004712.1_g000034 Rmu_sc0007533.1_g000004
rosa_roxburghii	Rroxscaffold_3G00270110
rosa_rugosa	Rorug06G0461200
rosa_samantha	Rh1DG157600 Rh7AG062100 Rh7BG062300 Rh7CG063700 Rh7DG062100
rosa_wichuraiana	Rw7G005130

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AatII	GACGTC	1 cut(s)	169
AclWI	GGATC	2 cut(s)	633, 646
AcsI	RAATTY	2 cut(s)	119, 439
AcuI	CTGAAG	2 cut(s)	69, 761
AcyI	GRCGYC	1 cut(s)	166
AfaI	GTAC	2 cut(s)	129, 522
AfiI	CCNNNNNNNGG	1 cut(s)	161
AflIII	ACRYGT	1 cut(s)	10
AgsI	TTSAA	8 cut(s)	119, 189, 355, 447, 488, 530, 769, 806
AhdI	GACNNNNNGTC	1 cut(s)	322
AjnI	CCWGG	2 cut(s)	181, 696
AluBI	AGCT	6 cut(s)	64, 231, 590, 608, 661, 745
AluI	AGCT	6 cut(s)	64, 231, 590, 608, 661, 745
Alw21I	GWGCWC	1 cut(s)	429
AlwI	GGATC	2 cut(s)	633, 646
Ama87I	CYCGRG	1 cut(s)	392
AoxI	GGCC	1 cut(s)	799
ApeKI	GCWGC	1 cut(s)	645
ApoI	RAATTY	2 cut(s)	119, 439
ArsI	GACNNNNNNTTYG	2 cut(s)	354, 386
AspS9I	GGNCC	1 cut(s)	29
AsuHPI	GGTGA	2 cut(s)	49, 355
AvaI	CYCGRG	1 cut(s)	392
AvaII	GGWCC	1 cut(s)	29
BamHI	GGATCC	1 cut(s)	638
BbsI	GAAGAC	1 cut(s)	86
Bbv12I	GWGCWC	1 cut(s)	429
BbvI	GCAGC	1 cut(s)	632
BccI	CCATC	1 cut(s)	20
BciT130I	CCWGG	2 cut(s)	183, 698
BfaI	CTAG	2 cut(s)	309, 470
BfmI	CTRYAG	1 cut(s)	555
BisI	GCNGC	1 cut(s)	646
BlsI	GCNGC	1 cut(s)	647
Bme1390I	CCNGG	2 cut(s)	183, 698
Bme18I	GGWCC	1 cut(s)	29
BmeRI	GACNNNNNGTC	1 cut(s)	322
BmeT110I	CYCGRG	1 cut(s)	392
BmgT120I	GGNCC	1 cut(s)	29
BmiI	GGNNCC	1 cut(s)	640
BmrFI	CCNGG	2 cut(s)	183, 698
BmsI	GCATC	5 cut(s)	53, 467, 523, 541, 697
BpiI	GAAGAC	1 cut(s)	86
BpuEI	CTTGAG	1 cut(s)	594
BsaHI	GRCGYC	1 cut(s)	166
BsaJI	CCNNGG	3 cut(s)	243, 649, 696
Bsc4I	CCNNNNNNNGG	1 cut(s)	161
Bse1I	ACTGG	2 cut(s)	422, 570
BseBI	CCWGG	2 cut(s)	183, 698
BseDI	CCNNGG	3 cut(s)	243, 649, 696
BseGI	GGATG	3 cut(s)	64, 458, 556
BseLI	CCNNNNNNNGG	1 cut(s)	161
BseMII	CTCAG	1 cut(s)	245
BseNI	ACTGG	2 cut(s)	422, 570
BseXI	GCAGC	1 cut(s)	632
BshFI	GGCC	1 cut(s)	801
BsiHKAI	GWGCWC	1 cut(s)	429
BsiHKCI	CYCGRG	1 cut(s)	392
BslI	CCNNNNNNNGG	1 cut(s)	161
BsmI	GAATGC	1 cut(s)	361
BsnI	GGCC	1 cut(s)	801
BsoBI	CYCGRG	1 cut(s)	392
Bsp1286I	GDGCHC	1 cut(s)	429
Bsp143I	GATC	4 cut(s)	345, 466, 613, 638
Bsp19I	CCATGG	1 cut(s)	649
BspANI	GGCC	1 cut(s)	801
BspCNI	CTCAG	1 cut(s)	246
BspLI	GGNNCC	1 cut(s)	640
BspPI	GGATC	2 cut(s)	633, 646
BsrI	ACTGG	2 cut(s)	422, 570
BssECI	CCNNGG	3 cut(s)	243, 649, 696
BssMI	GATC	4 cut(s)	345, 466, 613, 638
BssNI	GRCGYC	1 cut(s)	166
BssT1I	CCWWGG	2 cut(s)	243, 649
Bst2UI	CCWGG	2 cut(s)	183, 698
Bst4CI	ACNGT	1 cut(s)	92
BstACI	GRCGYC	1 cut(s)	166
BstC8I	GCNNGC	2 cut(s)	66, 152
BstDEI	CTNAG	2 cut(s)	158, 254
BstDSI	CCRYGG	1 cut(s)	649
BstENI	CCTNNNNNAGG	1 cut(s)	159
BstF5I	GGATG	3 cut(s)	64, 458, 556
BstKTI	GATC	4 cut(s)	348, 469, 616, 641
BstMBI	GATC	4 cut(s)	345, 466, 613, 638
BstNI	CCWGG	2 cut(s)	183, 698
BstNSI	RCATGY	2 cut(s)	14, 514
BstSCI	CCNGG	2 cut(s)	181, 696
BstSFI	CTRYAG	1 cut(s)	555
BstV1I	GCAGC	1 cut(s)	632
BstV2I	GAAGAC	1 cut(s)	86
BstX2I	RGATCY	1 cut(s)	638
BstYI	RGATCY	1 cut(s)	638
BsuRI	GGCC	1 cut(s)	801
BtgI	CCRYGG	1 cut(s)	649
BtsCI	GGATG	3 cut(s)	64, 458, 556
BtsI	GCAGTG	1 cut(s)	310
BtsIMutI	CAGTG	2 cut(s)	310, 429
Cac8I	GCNNGC	2 cut(s)	66, 152
Cfr13I	GGNCC	1 cut(s)	29
Csp6I	GTAC	2 cut(s)	128, 521
CspCI	CAANNNNNGTGG	2 cut(s)	393, 428
CviAII	CATG	6 cut(s)	11, 55, 80, 198, 511, 650
CviQI	GTAC	2 cut(s)	128, 521
DdeI	CTNAG	2 cut(s)	158, 254
DpnI	GATC	4 cut(s)	347, 468, 615, 640
DpnII	GATC	4 cut(s)	345, 466, 613, 638
DraI	TTTAAA	1 cut(s)	595
DriI	GACNNNNNGTC	1 cut(s)	322
Eam1105I	GACNNNNNGTC	1 cut(s)	322
Eco130I	CCWWGG	2 cut(s)	243, 649
Eco47I	GGWCC	1 cut(s)	29
Eco57I	CTGAAG	2 cut(s)	69, 761
Eco88I	CYCGRG	1 cut(s)	392
EcoNI	CCTNNNNNAGG	1 cut(s)	159
EcoRII	CCWGG	2 cut(s)	181, 696
EcoT14I	CCWWGG	2 cut(s)	243, 649
EcoT22I	ATGCAT	2 cut(s)	496, 516
ErhI	CCWWGG	2 cut(s)	243, 649
FaeI	CATG	6 cut(s)	14, 58, 83, 201, 514, 653
FatI	CATG	6 cut(s)	10, 54, 79, 197, 510, 649
Fnu4HI	GCNGC	1 cut(s)	646
FokI	GGATG	3 cut(s)	71, 445, 563
Fsp4HI	GCNGC	1 cut(s)	646
FspBI	CTAG	2 cut(s)	309, 470
GluI	GCNGC	1 cut(s)	646
HaeIII	GGCC	1 cut(s)	801
Hin1I	GRCGYC	1 cut(s)	166
Hin1II	CATG	6 cut(s)	14, 58, 83, 201, 514, 653
HindIII	AAGCTT	2 cut(s)	588, 659
HinfI	GANTC	3 cut(s)	178, 239, 526
HphI	GGTGA	2 cut(s)	49, 355
Hpy166II	GTNNAC	1 cut(s)	575
Hpy188I	TCNGA	6 cut(s)	88, 177, 297, 328, 466, 741
Hpy188III	TCNNGA	1 cut(s)	611
Hpy8I	GTNNAC	1 cut(s)	575
HpyAV	CCTTC	2 cut(s)	212, 812
HpyCH4III	ACNGT	1 cut(s)	92
HpyCH4IV	ACGT	1 cut(s)	166
HpyCH4V	TGCA	8 cut(s)	4, 44, 359, 384, 458, 494, 514, 719
HpyF3I	CTNAG	2 cut(s)	158, 254
HpySE526I	ACGT	1 cut(s)	166
Hsp92I	GRCGYC	1 cut(s)	166
Hsp92II	CATG	6 cut(s)	14, 58, 83, 201, 514, 653
Kzo9I	GATC	4 cut(s)	345, 466, 613, 638
LmnI	GCTCC	2 cut(s)	236, 473
Lsp1109I	GCAGC	1 cut(s)	632
LweI	GCATC	5 cut(s)	53, 467, 523, 541, 697
MaeI	CTAG	2 cut(s)	309, 470
MaeII	ACGT	1 cut(s)	166
MaeIII	GTNAC	3 cut(s)	37, 73, 730
MalI	GATC	4 cut(s)	347, 468, 615, 640
MboI	GATC	4 cut(s)	345, 466, 613, 638
MboII	GAAGA	3 cut(s)	86, 227, 554
MflI	RGATCY	1 cut(s)	638
MhlI	GDGCHC	1 cut(s)	429
MluCI	AATT	6 cut(s)	119, 224, 439, 447, 596, 720
MlyI	GAGTC	2 cut(s)	172, 233
Mph1103I	ATGCAT	2 cut(s)	496, 516
MseI	TTAA	5 cut(s)	132, 194, 227, 594, 723
MspR9I	CCNGG	2 cut(s)	183, 698
Mva1269I	GAATGC	1 cut(s)	361
MvaI	CCWGG	2 cut(s)	183, 698
NcoI	CCATGG	1 cut(s)	649
NdeII	GATC	4 cut(s)	345, 466, 613, 638
NlaIII	CATG	6 cut(s)	14, 58, 83, 201, 514, 653
NlaIV	GGNNCC	1 cut(s)	640
NmuCI	GTSAC	2 cut(s)	37, 73
NsiI	ATGCAT	2 cut(s)	496, 516
NspI	RCATGY	2 cut(s)	14, 514
PciI	ACATGT	1 cut(s)	10
PctI	GAATGC	1 cut(s)	361
PfeI	GAWTC	1 cut(s)	526
PkrI	GCNGC	1 cut(s)	647
PleI	GAGTC	2 cut(s)	172, 233
PpsI	GAGTC	2 cut(s)	172, 233
PscI	ACATGT	1 cut(s)	10
Psp6I	CCWGG	2 cut(s)	181, 696
PspGI	CCWGG	2 cut(s)	181, 696
PspN4I	GGNNCC	1 cut(s)	640
PspPI	GGNCC	1 cut(s)	29
PsuI	RGATCY	1 cut(s)	638
RsaI	GTAC	2 cut(s)	129, 522
RsaNI	GTAC	2 cut(s)	128, 521
SaqAI	TTAA	5 cut(s)	132, 194, 227, 594, 723
SatI	GCNGC	1 cut(s)	646
Sau3AI	GATC	4 cut(s)	345, 466, 613, 638
Sau96I	GGNCC	1 cut(s)	29
SchI	GAGTC	2 cut(s)	172, 233
ScrFI	CCNGG	2 cut(s)	183, 698
SduI	GDGCHC	1 cut(s)	429
SfaNI	GCATC	5 cut(s)	53, 467, 523, 541, 697
SfcI	CTRYAG	1 cut(s)	555
SinI	GGWCC	1 cut(s)	29
SmlI	CTYRAG	1 cut(s)	609
SmoI	CTYRAG	1 cut(s)	609
Sse9I	AATT	6 cut(s)	119, 224, 439, 447, 596, 720
SspMI	CTAG	2 cut(s)	309, 470
StyD4I	CCNGG	2 cut(s)	181, 696
StyI	CCWWGG	2 cut(s)	243, 649
TaaI	ACNGT	1 cut(s)	92
TaiI	ACGT	1 cut(s)	169
TaqI	TCGA	1 cut(s)	24
TasI	AATT	6 cut(s)	119, 224, 439, 447, 596, 720
TfiI	GAWTC	1 cut(s)	526
Tru1I	TTAA	5 cut(s)	132, 194, 227, 594, 723
Tru9I	TTAA	5 cut(s)	132, 194, 227, 594, 723
TscAI	CASTG	2 cut(s)	310, 429
TseFI	GTSAC	2 cut(s)	37, 73
TseI	GCWGC	1 cut(s)	645
Tsp45I	GTSAC	2 cut(s)	37, 73
TspDTI	ATGAA	4 cut(s)	43, 120, 345, 600
TspRI	CASTG	2 cut(s)	310, 429
VpaK11BI	GGWCC	1 cut(s)	29
XagI	CCTNNNNNAGG	1 cut(s)	159
XapI	RAATTY	2 cut(s)	119, 439
XceI	RCATGY	2 cut(s)	14, 514
XspI	CTAG	2 cut(s)	309, 470
ZraI	GACGTC	1 cut(s)	167
Zsp2I	ATGCAT	2 cut(s)	496, 516

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.