Rmu_co8468041.1_g000001

phagosome-lysosome fusion involved in apoptotic cell clearance

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8468041.1
Physical Location & Seq
Reverse (-)
2 .. 1677
1676 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8468041.1_g000001.1.cds

Sequence Viewer

Length: 1578 bp
atggatttgtctgtgggtgataaaggacttgctacacttcagttgctcaaatggggcccttctcagccccaactaaacttgtcagaatttcgtgaagccttcatttcacctacaagacagttattattattgctttcgtatcagtgtgaggctttattgtttcctctaattacaggtagtaataatttgcagtgtaatattgatgaaagtcttcaaagtccagagacagagcctggtaggtcagattcaataagggacgatttgccatgcacatctggatcattaggagatgttgataatgatttgagttttggaggggacagtttaagatctaaaagttacccttttgttggtgatgttaactctctggcttggggcgtttgtgaggacacttataatcagcacaaggatgctttatttagagagcttttgtttgtgtgtggcaagcaaggtattatggtccatgcttttgttgaatctaccggaaatactgcaacaaccagcaatgcacgggaaggtgggtatgggcaagggaggtgggttgagtgggggccttccgcttctttaattggaaatatggaggtggaggaacctaccagcttgagttctgaagctactggaaatattgaatttaacaaatccaatggaaacagtgaaagtccccatatttgtaatgtggatgggaatgaggagttctcaaaaagtgttgcttctaaaagatggttgcaatcttttttgactaaagttgaaaatgttgaatataatggtaaaatattgaccaggttcccggaaaagtcattgttgcctagctctgcaagagttgtttcatttagtttatttaatagtaatttggcaattttggactgccttgcaaacaatgattctgcatcagataaggcgtgcggtcaggaaacagttcatgagttggacagtgataaatctctgaaattagacataacttcatctgatccacatttcaagtctgagactttgtccaatcttttaggtgttggaatgaatagtgtgtacaaatgctgcagagtgttctcaagcaattctcattacttcattggatttgttttcacacaggttgatccggtaattgtcaatactagtgatgaaagtggaaaaagcaagaagaataatgtactgcttattgctagattagaccacatgggaattcattgggtttcctcagtgaagcttgacgaaagtccaaatattggctcagtagcacaatggacagacttccacttttctgataaacttcttgtttgtcttaatgcttgtgggctaattgtattttatgcagcaatgtcaggtgagtatgttgcacatatagatattttacagactttaggactcaactctgagttgcatttgcagaagcaggaagcagtttccacaggttatgataagcatattactcaagttgatgacattcagaacaaatcagttttgcaacatgttgattattctggcaggagactgtttaaaaggttgatttctgcttcacatacctctctagtagctgctattgatgattatggtgtaatatatgtggtttctgctggtgaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

526

Amino Acids

57.68

Weight (kDa)

4.97

Isoelectric Point (pI)

45.27

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 396
AccB7I CCANNNNNTGG 1 cut(s) 1223
AciI CCGC 2 cut(s) 558, 903
AclWI GGATC 3 cut(s) 286, 962, 1088
AcsI RAATTY 3 cut(s) 86, 629, 1179
AcuI CTGAAG 2 cut(s) 23, 630
AfaI GTAC 2 cut(s) 1028, 1149
AfiI CCNNNNNNNGG 2 cut(s) 350, 1223
AflIII ACRYGT 1 cut(s) 1465
AgsI TTSAA 7 cut(s) 215, 249, 476, 629, 749, 758, 979
AhlI ACTAGT 1 cut(s) 1112
AjnI CCWGG 2 cut(s) 232, 779
AluBI AGCT 6 cut(s) 427, 600, 614, 810, 1204, 1532
AluI AGCT 6 cut(s) 427, 600, 614, 810, 1204, 1532
Alw26I GTCTC 3 cut(s) 218, 980, 1480
AlwI GGATC 3 cut(s) 286, 962, 1088
AlwNI CAGNNNCTG 1 cut(s) 233
AoxI GGCC 2 cut(s) 55, 551
ApaI GGGCCC 1 cut(s) 59
ApeKI GCWGC 3 cut(s) 1035, 1310, 1532
ApoI RAATTY 3 cut(s) 86, 629, 1179
Asp700I GAANNNNTTC 2 cut(s) 210, 915
AspS9I GGNCC 4 cut(s) 55, 56, 460, 551
AsuC2I CCSGG 1 cut(s) 788
AsuHPI GGTGA 4 cut(s) 29, 99, 365, 1334
AvaII GGWCC 1 cut(s) 460
BaeGI GKGCMC 1 cut(s) 59
BanII GRGCYC 1 cut(s) 59
BbsI GAAGAC 1 cut(s) 203
BbvI GCAGC 3 cut(s) 1022, 1322, 1519
BccI CCATC 2 cut(s) 674, 714
BciT130I CCWGG 2 cut(s) 234, 781
BcnI CCSGG 1 cut(s) 788
BcoDI GTCTC 3 cut(s) 218, 980, 1480
BcuI ACTAGT 1 cut(s) 1112
BfaI CTAG 4 cut(s) 807, 1113, 1161, 1526
BfmI CTRYAG 1 cut(s) 1036
BglII AGATCT 1 cut(s) 329
BisI GCNGC 3 cut(s) 1036, 1311, 1533
BlsI GCNGC 3 cut(s) 1037, 1312, 1534
Bme1390I CCNGG 3 cut(s) 234, 781, 788
Bme18I GGWCC 1 cut(s) 460
BmgT120I GGNCC 4 cut(s) 55, 56, 460, 551
BmiI GGNNCC 5 cut(s) 56, 57, 552, 591, 785
BmrFI CCNGG 3 cut(s) 234, 781, 788
BmsI GCATC 2 cut(s) 400, 896
BoxI GACNNNNGTC 1 cut(s) 1212
BpiI GAAGAC 1 cut(s) 203
BplI GAGNNNNNCTC 2 cut(s) 680, 712
BpuEI CTTGAG 3 cut(s) 622, 1033, 1413
BpuMI CCSGG 1 cut(s) 788
BsaWI WCCGGW 2 cut(s) 482, 1096
Bsc4I CCNNNNNNNGG 2 cut(s) 350, 1223
Bse1I ACTGG 1 cut(s) 622
Bse3DI GCAATG 2 cut(s) 511, 1320
BseBI CCWGG 2 cut(s) 234, 781
BseGI GGATG 2 cut(s) 415, 685
BseLI CCNNNNNNNGG 2 cut(s) 350, 1223
BseMI GCAATG 2 cut(s) 511, 1320
BseMII CTCAG 5 cut(s) 77, 975, 1209, 1242, 1362
BseNI ACTGG 1 cut(s) 622
BseRI GAGGAG 1 cut(s) 704
BseSI GKGCMC 1 cut(s) 59
BseXI GCAGC 3 cut(s) 1022, 1322, 1519
BshFI GGCC 2 cut(s) 57, 553
BsiSI CCGG 3 cut(s) 483, 788, 1097
BslFI GGGAC 3 cut(s) 269, 332, 645
BslI CCNNNNNNNGG 2 cut(s) 350, 1223
BsmAI GTCTC 3 cut(s) 218, 980, 1480
BsmFI GGGAC 3 cut(s) 269, 332, 645
BsnI GGCC 2 cut(s) 57, 553
Bsp120I GGGCCC 1 cut(s) 55
Bsp1286I GDGCHC 1 cut(s) 59
Bsp1407I TGTACA 1 cut(s) 1026
Bsp143I GATC 4 cut(s) 278, 329, 967, 1093
BspACI CCGC 2 cut(s) 558, 903
BspANI GGCC 2 cut(s) 57, 553
BspCNI CTCAG 5 cut(s) 76, 976, 1208, 1241, 1363
BspHI TCATGA 1 cut(s) 919
BspLI GGNNCC 5 cut(s) 56, 57, 552, 591, 785
BspMAI CTGCAG 1 cut(s) 1040
BspPI GGATC 3 cut(s) 286, 962, 1088
BsrDI GCAATG 2 cut(s) 511, 1320
BsrGI TGTACA 1 cut(s) 1026
BsrI ACTGG 1 cut(s) 622
BssMI GATC 4 cut(s) 278, 329, 967, 1093
Bst2UI CCWGG 2 cut(s) 234, 781
Bst4CI ACNGT 6 cut(s) 120, 323, 653, 916, 932, 1491
BstAUI TGTACA 1 cut(s) 1026
BstC8I GCNNGC 2 cut(s) 446, 901
BstDEI CTNAG 5 cut(s) 63, 984, 1195, 1228, 1371
BstF5I GGATG 2 cut(s) 415, 685
BstKTI GATC 4 cut(s) 281, 332, 970, 1096
BstMAI GTCTC 3 cut(s) 218, 980, 1480
BstMBI GATC 4 cut(s) 278, 329, 967, 1093
BstNI CCWGG 2 cut(s) 234, 781
BstNSI RCATGY 1 cut(s) 1469
BstPAI GACNNNNGTC 1 cut(s) 1212
BstSCI CCNGG 3 cut(s) 232, 779, 786
BstSFI CTRYAG 1 cut(s) 1036
BstSLI GKGCMC 1 cut(s) 59
BstV1I GCAGC 3 cut(s) 1022, 1322, 1519
BstV2I GAAGAC 1 cut(s) 203
BstX2I RGATCY 1 cut(s) 329
BstYI RGATCY 1 cut(s) 329
BsuRI GGCC 2 cut(s) 57, 553
BtsCI GGATG 2 cut(s) 415, 685
BtsI GCAGTG 1 cut(s) 197
BtsIMutI CAGTG 5 cut(s) 149, 197, 658, 937, 1203
Cac8I GCNNGC 2 cut(s) 446, 901
CaiI CAGNNNCTG 1 cut(s) 233
CciI TCATGA 1 cut(s) 919
Cfr13I GGNCC 4 cut(s) 55, 56, 460, 551
CsiI ACCWGGT 1 cut(s) 779
Csp6I GTAC 2 cut(s) 1027, 1148
CspCI CAANNNNNGTGG 2 cut(s) 518, 553
CviAII CATG 5 cut(s) 267, 464, 920, 1174, 1466
CviQI GTAC 2 cut(s) 1027, 1148
DdeI CTNAG 5 cut(s) 63, 984, 1195, 1228, 1371
DpnI GATC 4 cut(s) 280, 331, 969, 1095
DpnII GATC 4 cut(s) 278, 329, 967, 1093
DraI TTTAAA 1 cut(s) 1495
Eco24I GRGCYC 1 cut(s) 59
Eco47I GGWCC 1 cut(s) 460
Eco57I CTGAAG 2 cut(s) 23, 630
EcoO109I RGGNCCY 3 cut(s) 55, 56, 551
EcoRI GAATTC 1 cut(s) 1179
EcoRII CCWGG 2 cut(s) 232, 779
EcoT38I GRGCYC 1 cut(s) 59
FaeI CATG 5 cut(s) 270, 467, 923, 1177, 1469
FalI AAGNNNNNCTT 4 cut(s) 328, 360, 694, 726
FaqI GGGAC 3 cut(s) 269, 332, 645
FatI CATG 5 cut(s) 266, 463, 919, 1173, 1465
Fnu4HI GCNGC 3 cut(s) 1036, 1311, 1533
FokI GGATG 2 cut(s) 422, 692
FriOI GRGCYC 1 cut(s) 59
Fsp4HI GCNGC 3 cut(s) 1036, 1311, 1533
FspBI CTAG 4 cut(s) 807, 1113, 1161, 1526
GluI GCNGC 3 cut(s) 1036, 1311, 1533
HaeIII GGCC 2 cut(s) 57, 553
HapII CCGG 3 cut(s) 483, 788, 1097
Hin1II CATG 5 cut(s) 270, 467, 923, 1177, 1469
HincII GTYRAC 1 cut(s) 361
HindII GTYRAC 1 cut(s) 361
HindIII AAGCTT 1 cut(s) 1202
HinfI GANTC 4 cut(s) 245, 476, 881, 1362
HpaI GTTAAC 1 cut(s) 361
HpaII CCGG 3 cut(s) 483, 788, 1097
HphI GGTGA 4 cut(s) 29, 99, 365, 1334
Hpy166II GTNNAC 2 cut(s) 361, 1027
Hpy188III TCNNGA 5 cut(s) 92, 221, 276, 908, 920
Hpy8I GTNNAC 2 cut(s) 361, 1027
HpyAV CCTTC 4 cut(s) 69, 109, 509, 564
HpyCH4III ACNGT 6 cut(s) 120, 323, 653, 916, 932, 1491
HpyF3I CTNAG 5 cut(s) 63, 984, 1195, 1228, 1371
Hsp92II CATG 5 cut(s) 270, 467, 923, 1177, 1469
KspAI GTTAAC 1 cut(s) 361
Kzo9I GATC 4 cut(s) 278, 329, 967, 1093
Lsp1109I GCAGC 3 cut(s) 1022, 1322, 1519
LweI GCATC 2 cut(s) 400, 896
MabI ACCWGGT 1 cut(s) 779
MaeI CTAG 4 cut(s) 807, 1113, 1161, 1526
MaeIII GTNAC 1 cut(s) 338
MalI GATC 4 cut(s) 280, 331, 969, 1095
MboI GATC 4 cut(s) 278, 329, 967, 1093
MboII GAAGA 2 cut(s) 203, 1150
MflI RGATCY 1 cut(s) 329
MhlI GDGCHC 1 cut(s) 59
MlyI GAGTC 1 cut(s) 1356
MmeI TCCRAC 2 cut(s) 906, 991
MroXI GAANNNNTTC 2 cut(s) 210, 915
MseI TTAA 7 cut(s) 326, 360, 566, 633, 840, 1281, 1494
MslI CAYNNNNRTG 1 cut(s) 408
MspI CCGG 3 cut(s) 483, 788, 1097
MspR9I CCNGG 3 cut(s) 234, 781, 788
MvaI CCWGG 2 cut(s) 234, 781
NciI CCSGG 1 cut(s) 788
NdeII GATC 4 cut(s) 278, 329, 967, 1093
NlaIII CATG 5 cut(s) 270, 467, 923, 1177, 1469
NlaIV GGNNCC 5 cut(s) 56, 57, 552, 591, 785
NspI RCATGY 1 cut(s) 1469
PagI TCATGA 1 cut(s) 919
PciI ACATGT 1 cut(s) 1465
PdmI GAANNNNTTC 2 cut(s) 210, 915
PfeI GAWTC 3 cut(s) 245, 476, 881
PflFI GACNNNGTC 1 cut(s) 991
PflMI CCANNNNNTGG 1 cut(s) 1223
PfoI TCCNGGA 1 cut(s) 786
PkrI GCNGC 3 cut(s) 1037, 1312, 1534
PleI GAGTC 1 cut(s) 1356
PpsI GAGTC 1 cut(s) 1356
PscI ACATGT 1 cut(s) 1465
PshAI GACNNNNGTC 1 cut(s) 1212
PsiI TTATAA 1 cut(s) 396
Psp6I CCWGG 2 cut(s) 232, 779
PspGI CCWGG 2 cut(s) 232, 779
PspN4I GGNNCC 5 cut(s) 56, 57, 552, 591, 785
PspOMI GGGCCC 1 cut(s) 55
PspPI GGNCC 4 cut(s) 55, 56, 460, 551
PstI CTGCAG 1 cut(s) 1040
PstNI CAGNNNCTG 1 cut(s) 233
PsuI RGATCY 1 cut(s) 329
PsyI GACNNNGTC 1 cut(s) 991
RsaI GTAC 2 cut(s) 1028, 1149
RsaNI GTAC 2 cut(s) 1027, 1148
RseI CAYNNNNRTG 1 cut(s) 408
SaqAI TTAA 7 cut(s) 326, 360, 566, 633, 840, 1281, 1494
SatI GCNGC 3 cut(s) 1036, 1311, 1533
Sau3AI GATC 4 cut(s) 278, 329, 967, 1093
Sau96I GGNCC 4 cut(s) 55, 56, 460, 551
SchI GAGTC 1 cut(s) 1356
ScrFI CCNGG 3 cut(s) 234, 781, 788
SduI GDGCHC 1 cut(s) 59
SexAI ACCWGGT 1 cut(s) 779
SfaNI GCATC 2 cut(s) 400, 896
SfcI CTRYAG 1 cut(s) 1036
SinI GGWCC 1 cut(s) 460
SmiMI CAYNNNNRTG 1 cut(s) 408
SmlI CTYRAG 3 cut(s) 601, 1048, 1428
SmoI CTYRAG 3 cut(s) 601, 1048, 1428
SpeI ACTAGT 1 cut(s) 1112
SsiI CCGC 2 cut(s) 558, 903
SspI AATATT 4 cut(s) 199, 625, 774, 1222
SspMI CTAG 4 cut(s) 807, 1113, 1161, 1526
StyD4I CCNGG 3 cut(s) 232, 779, 786
TaaI ACNGT 6 cut(s) 120, 323, 653, 916, 932, 1491
TatI WGTACW 2 cut(s) 1026, 1147
TfiI GAWTC 3 cut(s) 245, 476, 881
Tru1I TTAA 7 cut(s) 326, 360, 566, 633, 840, 1281, 1494
Tru9I TTAA 7 cut(s) 326, 360, 566, 633, 840, 1281, 1494
TscAI CASTG 5 cut(s) 149, 197, 658, 937, 1203
TseI GCWGC 3 cut(s) 1035, 1310, 1532
TspDTI ATGAA 9 cut(s) 91, 219, 816, 908, 951, 1031, 1057, 1134, 1172
TspRI CASTG 5 cut(s) 149, 197, 658, 937, 1203
Tth111I GACNNNGTC 1 cut(s) 991
Van91I CCANNNNNTGG 1 cut(s) 1223
VpaK11BI GGWCC 1 cut(s) 460
XapI RAATTY 3 cut(s) 86, 629, 1179
XceI RCATGY 1 cut(s) 1469
XmnI GAANNNNTTC 2 cut(s) 210, 915
XspI CTAG 4 cut(s) 807, 1113, 1161, 1526
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.