Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_co8479241.1

Orthogroup ID

OG0009019

Physical Location & Seq

Genomic Coordinates Forward (+)

1 .. 2169

Gene Structure 2169 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_co8479241.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 258 bp

acccgacctttcgtcaaggtgatcgaaatgggttccaaggagaacaatcaaggtctcgttaggcctgcaaatgtccaaggtccaggattgttggggggttccaagtttgtgaaggagattgggcacaatcatcgagcggcactaagcaatatcaccaatttgaaaagagaggcttctgggaatgatgcggctggtgataagaaattgtcaaatctgggacatagacccattacaaggttggaactcattcttagttga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Cyclin_C Cyclin_N

Protein Analysis

85

Amino Acids

9.14

Weight (kDa)

10.36

Isoelectric Point (pI)

35.83

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0009019)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G20610 AT1G76310 AT1G76310 AT1G76310 AT1G76310
fragaria_vesca	FvH4_2g16590
malus_domestica	MD05G1134100.v1.1 MD10G1139200.v1.1
prunus_persica	Prupe.8G177900_v2.0.a1
pyrus_communis	pycom05g13080 pycom10g11830
rosa_chinensis	RchiOBHm_Chr6g0280651
rosa_laevigata	RLG00000013039
rosa_multiflora	Rmu_co8479241.1_g000001 Rmu_sc0000976.1_g000005
rosa_roxburghii	Rroxscaffold_7G00187790
rosa_rugosa	Rorug06G0133400 Rorug06G0133400
rosa_samantha	Rh6AG246000 Rh6BG248300 Rh6CG249600
rosa_wichuraiana	Rw6G021290

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccBSI	CCGCTC	1 cut(s)	137
AciI	CCGC	2 cut(s)	137, 188
AfiI	CCNNNNNNNGG	1 cut(s)	234
AgsI	TTSAA	1 cut(s)	163
AhdI	GACNNNNNGTC	1 cut(s)	11
AjnI	CCWGG	1 cut(s)	82
Alw26I	GTCTC	1 cut(s)	59
AoxI	GGCC	1 cut(s)	62
Asp700I	GAANNNNTTC	1 cut(s)	246
AspS9I	GGNCC	1 cut(s)	80
AsuHPI	GGTGA	3 cut(s)	31, 145, 206
AvaII	GGWCC	1 cut(s)	80
BaeGI	GKGCMC	1 cut(s)	126
BcgI	CGANNNNNNTGC	2 cut(s)	113, 147
BciT130I	CCWGG	1 cut(s)	84
BcoDI	GTCTC	1 cut(s)	59
BisI	GCNGC	2 cut(s)	138, 189
BlsI	GCNGC	2 cut(s)	139, 190
Bme1390I	CCNGG	1 cut(s)	84
Bme18I	GGWCC	1 cut(s)	80
BmeRI	GACNNNNNGTC	1 cut(s)	11
BmgT120I	GGNCC	1 cut(s)	80
BmiI	GGNNCC	2 cut(s)	34, 100
BmrFI	CCNGG	1 cut(s)	84
BmsI	GCATC	1 cut(s)	175
BsaI	GGTCTC	1 cut(s)	59
BsaJI	CCNNGG	2 cut(s)	36, 76
Bsc4I	CCNNNNNNNGG	1 cut(s)	234
BseBI	CCWGG	1 cut(s)	84
BseDI	CCNNGG	2 cut(s)	36, 76
BseLI	CCNNNNNNNGG	1 cut(s)	234
BseSI	GKGCMC	1 cut(s)	126
BshFI	GGCC	1 cut(s)	64
BslFI	GGGAC	1 cut(s)	231
BslI	CCNNNNNNNGG	1 cut(s)	234
BsmAI	GTCTC	1 cut(s)	59
BsmFI	GGGAC	1 cut(s)	231
BsnI	GGCC	1 cut(s)	64
Bso31I	GGTCTC	1 cut(s)	59
Bsp1286I	GDGCHC	1 cut(s)	126
Bsp143I	GATC	1 cut(s)	21
BspACI	CCGC	2 cut(s)	137, 188
BspANI	GGCC	1 cut(s)	64
BspLI	GGNNCC	2 cut(s)	34, 100
BspTNI	GGTCTC	1 cut(s)	59
BsrBI	CCGCTC	1 cut(s)	137
BssECI	CCNNGG	2 cut(s)	36, 76
BssMI	GATC	1 cut(s)	21
BssT1I	CCWWGG	2 cut(s)	36, 76
Bst2UI	CCWGG	1 cut(s)	84
BstC8I	GCNNGC	1 cut(s)	66
BstDEI	CTNAG	2 cut(s)	143, 251
BstKTI	GATC	1 cut(s)	24
BstMAI	GTCTC	1 cut(s)	59
BstMBI	GATC	1 cut(s)	21
BstNI	CCWGG	1 cut(s)	84
BstSCI	CCNGG	1 cut(s)	82
BstSLI	GKGCMC	1 cut(s)	126
BsuRI	GGCC	1 cut(s)	64
Cac8I	GCNNGC	1 cut(s)	66
Cfr13I	GGNCC	1 cut(s)	80
CviJI	RGCY	3 cut(s)	64, 173, 191
CviKI_1	RGCY	3 cut(s)	64, 173, 191
DdeI	CTNAG	2 cut(s)	143, 251
DpnI	GATC	1 cut(s)	23
DpnII	GATC	1 cut(s)	21
DriI	GACNNNNNGTC	1 cut(s)	11
Eam1105I	GACNNNNNGTC	1 cut(s)	11
Eco130I	CCWWGG	2 cut(s)	36, 76
Eco147I	AGGCCT	1 cut(s)	64
Eco31I	GGTCTC	1 cut(s)	59
Eco47I	GGWCC	1 cut(s)	80
EcoRII	CCWGG	1 cut(s)	82
EcoT14I	CCWWGG	2 cut(s)	36, 76
ErhI	CCWWGG	2 cut(s)	36, 76
FaiI	YATR	1 cut(s)	222
FalI	AAGNNNNNCTT	2 cut(s)	157, 189
FaqI	GGGAC	1 cut(s)	231
Fnu4HI	GCNGC	2 cut(s)	138, 189
Fsp4HI	GCNGC	2 cut(s)	138, 189
GluI	GCNGC	2 cut(s)	138, 189
HaeIII	GGCC	1 cut(s)	64
HphI	GGTGA	3 cut(s)	31, 145, 206
HpyAV	CCTTC	1 cut(s)	106
HpyCH4V	TGCA	1 cut(s)	68
HpyF3I	CTNAG	2 cut(s)	143, 251
Kzo9I	GATC	1 cut(s)	21
LpnPI	CCDG	6 cut(s)	69, 78, 96, 162, 177, 200
LweI	GCATC	1 cut(s)	175
MalI	GATC	1 cut(s)	23
MbiI	CCGCTC	1 cut(s)	137
MboI	GATC	1 cut(s)	21
MhlI	GDGCHC	1 cut(s)	126
MluCI	AATT	2 cut(s)	157, 203
MmeI	TCCRAC	1 cut(s)	219
MnlI	CCTC	1 cut(s)	163
MroXI	GAANNNNTTC	1 cut(s)	246
MspR9I	CCNGG	1 cut(s)	84
MvaI	CCWGG	1 cut(s)	84
NdeII	GATC	1 cut(s)	21
NlaIV	GGNNCC	2 cut(s)	34, 100
PceI	AGGCCT	1 cut(s)	64
PdmI	GAANNNNTTC	1 cut(s)	246
PfoI	TCCNGGA	1 cut(s)	82
PkrI	GCNGC	2 cut(s)	139, 190
Psp6I	CCWGG	1 cut(s)	82
PspGI	CCWGG	1 cut(s)	82
PspN4I	GGNNCC	2 cut(s)	34, 100
PspPI	GGNCC	1 cut(s)	80
SatI	GCNGC	2 cut(s)	138, 189
Sau3AI	GATC	1 cut(s)	21
Sau96I	GGNCC	1 cut(s)	80
ScrFI	CCNGG	1 cut(s)	84
SduI	GDGCHC	1 cut(s)	126
SetI	ASST	5 cut(s)	10, 21, 55, 82, 239
SfaNI	GCATC	1 cut(s)	175
SinI	GGWCC	1 cut(s)	80
Sse9I	AATT	2 cut(s)	157, 203
SseBI	AGGCCT	1 cut(s)	64
SsiI	CCGC	2 cut(s)	137, 188
StuI	AGGCCT	1 cut(s)	64
StyD4I	CCNGG	1 cut(s)	82
StyI	CCWWGG	2 cut(s)	36, 76
TaqI	TCGA	2 cut(s)	24, 133
TasI	AATT	2 cut(s)	157, 203
TauI	GCSGC	2 cut(s)	140, 191
VpaK11BI	GGWCC	1 cut(s)	80
XcmI	CCANNNNNNNNNTGG	1 cut(s)	235
XmnI	GAANNNNTTC	1 cut(s)	246

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.