Rmu_co8480455.1_g000001

Belongs to the SNF7 family

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8480455.1
Physical Location & Seq
Reverse (-)
1109 .. 2196
1088 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8480455.1_g000001.1.cds

Sequence Viewer

Length: 684 bp
atgaaatttgcacgacccattttggatatcaggcctgtagctggcttgttgaaaaaattcattgacattggtccccataggataaccagaggctattggttaagaaaatcagcattagcttgtttgcattccggaaacaagaaagtggctctgaggcatgcaagggagttgaagttggcgaatgagagtagagaaaaatgtgcaaacttcttgaacagagtgatggaagtgcttgattttatcgcaaatgctgaattgacaaagaaggtttctgaagccatccaaattggagctaaagctataaaggaaaataggattagtatggaagaagtcgaagatagcctacaagaaattgaggagagcattgatacattaaagcaattagaaaatgttatagaatcaacccccctgtactcagttacggatgatgaagaaaatatcgaagaggagttcaagaaactagaactggatattggacttgaaaacgatcacaaaccaatccaggaaaccgagattaataatgcagtagaaacagacatttcagaatctgctgaagcgttgatagattctttatcaaatctcaagctcgtggatggtggtcaagcaaggataccagcagttcacagcactgcctcgacagcaagaaacaacaaaacaaaaggtcctgagcttgcaactgcctaa

Protein Analysis

227

Amino Acids

25.34

Weight (kDa)

5.23

Isoelectric Point (pI)

45.3

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccIII TCCGGA 1 cut(s) 131
AcsI RAATTY 2 cut(s) 5, 56
AcuI CTGAAG 2 cut(s) 294, 573
AfaI GTAC 1 cut(s) 413
AfiI CCNNNNNNNGG 1 cut(s) 41
AgsI TTSAA 5 cut(s) 52, 172, 214, 454, 482
AjnI CCWGG 1 cut(s) 501
AjuI GAANNNNNNNTTGG 2 cut(s) 456, 488
AluBI AGCT 6 cut(s) 41, 119, 293, 299, 586, 670
AluI AGCT 6 cut(s) 41, 119, 293, 299, 586, 670
AlwNI CAGNNNCTG 1 cut(s) 548
Aor13HI TCCGGA 1 cut(s) 131
AoxI GGCC 1 cut(s) 32
ApoI RAATTY 2 cut(s) 5, 56
AseI ATTAAT 1 cut(s) 516
Asp700I GAANNNNTTC 1 cut(s) 56
AspS9I GGNCC 2 cut(s) 71, 662
AvaII GGWCC 2 cut(s) 71, 662
BarI GAAGNNNNNNTAC 2 cut(s) 327, 359
BauI CACGAG 1 cut(s) 587
BccI CCATC 3 cut(s) 217, 287, 587
BciT130I CCWGG 1 cut(s) 503
BciVI GTATCC 1 cut(s) 603
BfaI CTAG 1 cut(s) 461
BfmI CTRYAG 1 cut(s) 36
BfuI GTATCC 1 cut(s) 603
Bme1390I CCNGG 1 cut(s) 503
Bme18I GGWCC 2 cut(s) 71, 662
BmgT120I GGNCC 2 cut(s) 71, 662
BmiI GGNNCC 1 cut(s) 73
BmrFI CCNGG 1 cut(s) 503
BoxI GACNNNNGTC 1 cut(s) 69
Bpu10I CCTNAGC 1 cut(s) 666
BpuEI CTTGAG 1 cut(s) 566
BsaWI WCCGGW 1 cut(s) 131
BsaXI ACNNNNNCTCC 2 cut(s) 158, 188
Bsc4I CCNNNNNNNGG 1 cut(s) 41
Bse1I ACTGG 1 cut(s) 471
BseAI TCCGGA 1 cut(s) 131
BseBI CCWGG 1 cut(s) 503
BseGI GGATG 3 cut(s) 279, 430, 598
BseLI CCNNNNNNNGG 1 cut(s) 41
BseMII CTCAG 3 cut(s) 143, 429, 657
BseNI ACTGG 1 cut(s) 471
BseRI GAGGAG 2 cut(s) 371, 461
BshFI GGCC 1 cut(s) 34
BsiSI CCGG 1 cut(s) 132
BslFI GGGAC 1 cut(s) 57
BslI CCNNNNNNNGG 1 cut(s) 41
BsmFI GGGAC 1 cut(s) 57
BsmI GAATGC 1 cut(s) 127
BsnI GGCC 1 cut(s) 34
Bsp13I TCCGGA 1 cut(s) 131
Bsp143I GATC 1 cut(s) 487
BspANI GGCC 1 cut(s) 34
BspCNI CTCAG 3 cut(s) 144, 428, 658
BspEI TCCGGA 1 cut(s) 131
BspLI GGNNCC 1 cut(s) 73
BsrI ACTGG 1 cut(s) 471
BssMI GATC 1 cut(s) 487
BssSI CACGAG 1 cut(s) 587
Bst2BI CACGAG 1 cut(s) 587
Bst2UI CCWGG 1 cut(s) 503
Bst6I CTCTTC 1 cut(s) 438
BstC8I GCNNGC 3 cut(s) 43, 159, 672
BstDEI CTNAG 3 cut(s) 152, 415, 666
BstF5I GGATG 3 cut(s) 279, 430, 598
BstKTI GATC 1 cut(s) 490
BstMBI GATC 1 cut(s) 487
BstMWI GCNNNNNNNGC 1 cut(s) 638
BstNI CCWGG 1 cut(s) 503
BstNSI RCATGY 1 cut(s) 161
BstPAI GACNNNNGTC 1 cut(s) 69
BstSCI CCNGG 1 cut(s) 501
BstSFI CTRYAG 1 cut(s) 36
BsuI GTATCC 1 cut(s) 603
BsuRI GGCC 1 cut(s) 34
BtsCI GGATG 3 cut(s) 279, 430, 598
BtsI GCAGTG 1 cut(s) 627
BtsIMutI CAGTG 1 cut(s) 627
Cac8I GCNNGC 3 cut(s) 43, 159, 672
CaiI CAGNNNCTG 1 cut(s) 548
Cfr13I GGNCC 2 cut(s) 71, 662
Csp6I GTAC 1 cut(s) 412
CviAII CATG 1 cut(s) 158
CviQI GTAC 1 cut(s) 412
DdeI CTNAG 3 cut(s) 152, 415, 666
DpnI GATC 1 cut(s) 489
DpnII GATC 1 cut(s) 487
Eam1104I CTCTTC 1 cut(s) 438
EarI CTCTTC 1 cut(s) 438
Eco147I AGGCCT 1 cut(s) 34
Eco32I GATATC 1 cut(s) 28
Eco47I GGWCC 2 cut(s) 71, 662
Eco57I CTGAAG 2 cut(s) 294, 573
EcoO109I RGGNCCY 1 cut(s) 662
EcoRII CCWGG 1 cut(s) 501
EcoRV GATATC 1 cut(s) 28
FaeI CATG 1 cut(s) 161
FaiI YATR 5 cut(s) 78, 159, 302, 323, 395
FaqI GGGAC 1 cut(s) 57
FatI CATG 1 cut(s) 157
FokI GGATG 3 cut(s) 266, 437, 605
FspBI CTAG 1 cut(s) 461
HaeIII GGCC 1 cut(s) 34
HapII CCGG 1 cut(s) 132
Hin1II CATG 1 cut(s) 161
HinfI GANTC 3 cut(s) 398, 545, 566
HpaII CCGG 1 cut(s) 132
Hpy166II GTNNAC 1 cut(s) 622
Hpy188I TCNGA 3 cut(s) 153, 274, 544
Hpy188III TCNNGA 4 cut(s) 132, 211, 454, 665
Hpy8I GTNNAC 1 cut(s) 622
HpyAV CCTTC 1 cut(s) 259
HpyCH4V TGCA 6 cut(s) 11, 127, 161, 203, 524, 674
HpyF10VI GCNNNNNNNGC 1 cut(s) 638
HpyF3I CTNAG 3 cut(s) 152, 415, 666
Hsp92II CATG 1 cut(s) 161
Kpn2I TCCGGA 1 cut(s) 131
Kzo9I GATC 1 cut(s) 487
LmnI GCTCC 1 cut(s) 290
MaeI CTAG 1 cut(s) 461
MaeIII GTNAC 1 cut(s) 418
MalI GATC 1 cut(s) 489
MboI GATC 1 cut(s) 487
MboII GAAGA 4 cut(s) 338, 347, 443, 455
MluCI AATT 6 cut(s) 5, 56, 254, 285, 351, 380
MnlI CCTC 5 cut(s) 83, 147, 349, 439, 643
MroI TCCGGA 1 cut(s) 131
MroXI GAANNNNTTC 1 cut(s) 56
MseI TTAA 3 cut(s) 101, 374, 516
MspI CCGG 1 cut(s) 132
MspR9I CCNGG 1 cut(s) 503
Mva1269I GAATGC 1 cut(s) 127
MvaI CCWGG 1 cut(s) 503
MwoI GCNNNNNNNGC 1 cut(s) 638
NdeII GATC 1 cut(s) 487
NlaIII CATG 1 cut(s) 161
NlaIV GGNNCC 1 cut(s) 73
NspI RCATGY 1 cut(s) 161
PaeI GCATGC 1 cut(s) 161
PceI AGGCCT 1 cut(s) 34
PctI GAATGC 1 cut(s) 127
PdmI GAANNNNTTC 1 cut(s) 56
PfeI GAWTC 3 cut(s) 398, 545, 566
PfoI TCCNGGA 1 cut(s) 501
PpuMI RGGWCCY 1 cut(s) 662
PshAI GACNNNNGTC 1 cut(s) 69
PshBI ATTAAT 1 cut(s) 516
Psp5II RGGWCCY 1 cut(s) 662
Psp6I CCWGG 1 cut(s) 501
PspGI CCWGG 1 cut(s) 501
PspN4I GGNNCC 1 cut(s) 73
PspPI GGNCC 2 cut(s) 71, 662
PspPPI RGGWCCY 1 cut(s) 662
PstNI CAGNNNCTG 1 cut(s) 548
RsaI GTAC 1 cut(s) 413
RsaNI GTAC 1 cut(s) 412
SaqAI TTAA 3 cut(s) 101, 374, 516
Sau3AI GATC 1 cut(s) 487
Sau96I GGNCC 2 cut(s) 71, 662
ScrFI CCNGG 1 cut(s) 503
SetI ASST 8 cut(s) 43, 121, 270, 295, 301, 588, 664, 672
SfcI CTRYAG 1 cut(s) 36
SinI GGWCC 2 cut(s) 71, 662
SmlI CTYRAG 1 cut(s) 581
SmoI CTYRAG 1 cut(s) 581
SphI GCATGC 1 cut(s) 161
Sse9I AATT 6 cut(s) 5, 56, 254, 285, 351, 380
SseBI AGGCCT 1 cut(s) 34
SspMI CTAG 1 cut(s) 461
StuI AGGCCT 1 cut(s) 34
StyD4I CCNGG 1 cut(s) 501
TaqI TCGA 3 cut(s) 333, 441, 635
TasI AATT 6 cut(s) 5, 56, 254, 285, 351, 380
TatI WGTACW 1 cut(s) 411
TfiI GAWTC 3 cut(s) 398, 545, 566
Tru1I TTAA 3 cut(s) 101, 374, 516
Tru9I TTAA 3 cut(s) 101, 374, 516
TscAI CASTG 1 cut(s) 634
TspDTI ATGAA 3 cut(s) 17, 49, 444
TspGWI ACGGA 1 cut(s) 437
TspRI CASTG 1 cut(s) 634
VpaK11BI GGWCC 2 cut(s) 71, 662
VspI ATTAAT 1 cut(s) 516
XapI RAATTY 2 cut(s) 5, 56
XceI RCATGY 1 cut(s) 161
XmnI GAANNNNTTC 1 cut(s) 56
XspI CTAG 1 cut(s) 461
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.