Rmu_co8513721.1_g000001

Belongs to the yippee family

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8513721.1
Physical Location & Seq
Reverse (-)
1551 .. 4108
2558 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8513721.1_g000001.1.cds

Sequence Viewer

Length: 285 bp
tctttcaactgccgtcgagggagggcatatctgttcagcaatgtggtgaatataacgcttggtcctgaggaagagaggctaatgctttctggtttgcatactgtagaagatattttttgtgtctgctgcggacagattcttggctggaaatatgtaattgcacatgacaaaaaccaaaagtacaaggaaggaaagtttgtgctagagagatggaggatagaggaggatgtagcggaggaattcaatctggatactcgcccaggttcaagtgatgaaattccttga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

94

Amino Acids

10.91

Weight (kDa)

5.14

Isoelectric Point (pI)

52.53

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 129, 233
AcsI RAATTY 2 cut(s) 239, 276
AfaI GTAC 1 cut(s) 182
AgsI TTSAA 3 cut(s) 7, 244, 267
AjnI CCWGG 1 cut(s) 259
ApeKI GCWGC 1 cut(s) 126
ApoI RAATTY 2 cut(s) 239, 276
AspS9I GGNCC 1 cut(s) 62
AsuHPI GGTGA 1 cut(s) 58
AvaII GGWCC 1 cut(s) 62
AxyI CCTNAGG 1 cut(s) 66
BbvI GCAGC 1 cut(s) 113
BccI CCATC 1 cut(s) 204
BciT130I CCWGG 1 cut(s) 261
BciVI GTATCC 1 cut(s) 244
BfaI CTAG 1 cut(s) 203
BfmI CTRYAG 1 cut(s) 102
BfuI GTATCC 1 cut(s) 244
BisI GCNGC 1 cut(s) 127
BlsI GCNGC 1 cut(s) 128
Bme1390I CCNGG 1 cut(s) 261
Bme18I GGWCC 1 cut(s) 62
BmgT120I GGNCC 1 cut(s) 62
BmrFI CCNGG 1 cut(s) 261
BsaJI CCNNGG 1 cut(s) 259
Bse21I CCTNAGG 1 cut(s) 66
Bse3DI GCAATG 1 cut(s) 46
BseBI CCWGG 1 cut(s) 261
BseDI CCNNGG 1 cut(s) 259
BseGI GGATG 1 cut(s) 232
BseMI GCAATG 1 cut(s) 46
BseMII CTCAG 1 cut(s) 57
BseRI GAGGAG 1 cut(s) 236
BseXI GCAGC 1 cut(s) 113
BspACI CCGC 2 cut(s) 129, 233
BspCNI CTCAG 1 cut(s) 58
BsrDI GCAATG 1 cut(s) 46
BssECI CCNNGG 1 cut(s) 259
Bst2UI CCWGG 1 cut(s) 261
Bst4CI ACNGT 1 cut(s) 103
Bst6I CTCTTC 1 cut(s) 66
BstDEI CTNAG 1 cut(s) 66
BstF5I GGATG 1 cut(s) 232
BstNI CCWGG 1 cut(s) 261
BstSCI CCNGG 1 cut(s) 259
BstSFI CTRYAG 1 cut(s) 102
BstV1I GCAGC 1 cut(s) 113
Bsu36I CCTNAGG 1 cut(s) 66
BsuI GTATCC 1 cut(s) 244
BtsCI GGATG 1 cut(s) 232
Cfr13I GGNCC 1 cut(s) 62
Csp6I GTAC 1 cut(s) 181
CviAII CATG 1 cut(s) 164
CviJI RGCY 2 cut(s) 79, 144
CviKI_1 RGCY 2 cut(s) 79, 144
CviQI GTAC 1 cut(s) 181
DdeI CTNAG 1 cut(s) 66
Eam1104I CTCTTC 1 cut(s) 66
EarI CTCTTC 1 cut(s) 66
Eco47I GGWCC 1 cut(s) 62
Eco81I CCTNAGG 1 cut(s) 66
EcoRI GAATTC 1 cut(s) 239
EcoRII CCWGG 1 cut(s) 259
FaeI CATG 1 cut(s) 167
FaiI YATR 5 cut(s) 28, 53, 99, 153, 165
FatI CATG 1 cut(s) 163
Fnu4HI GCNGC 1 cut(s) 127
FokI GGATG 1 cut(s) 239
Fsp4HI GCNGC 1 cut(s) 127
FspBI CTAG 1 cut(s) 203
GluI GCNGC 1 cut(s) 127
Hin1II CATG 1 cut(s) 167
HinfI GANTC 1 cut(s) 136
HphI GGTGA 1 cut(s) 58
Hpy188III TCNNGA 2 cut(s) 65, 248
Hpy99I CGWCG 1 cut(s) 18
HpyAV CCTTC 1 cut(s) 182
HpyCH4III ACNGT 1 cut(s) 103
HpyCH4V TGCA 2 cut(s) 97, 161
HpyF3I CTNAG 1 cut(s) 66
Hsp92II CATG 1 cut(s) 167
LpnPI CCDG 6 cut(s) 75, 78, 130, 233, 246, 273
Lsp1109I GCAGC 1 cut(s) 113
MaeI CTAG 1 cut(s) 203
MboII GAAGA 2 cut(s) 83, 119
MluCI AATT 3 cut(s) 156, 239, 276
MnlI CCTC 8 cut(s) 11, 15, 61, 69, 207, 214, 217, 229
MspR9I CCNGG 1 cut(s) 261
MvaI CCWGG 1 cut(s) 261
NlaIII CATG 1 cut(s) 167
PfeI GAWTC 1 cut(s) 136
PkrI GCNGC 1 cut(s) 128
Psp6I CCWGG 1 cut(s) 259
PspGI CCWGG 1 cut(s) 259
PspPI GGNCC 1 cut(s) 62
RsaI GTAC 1 cut(s) 182
RsaNI GTAC 1 cut(s) 181
SatI GCNGC 1 cut(s) 127
Sau96I GGNCC 1 cut(s) 62
ScrFI CCNGG 1 cut(s) 261
SetI ASST 1 cut(s) 265
SfcI CTRYAG 1 cut(s) 102
SinI GGWCC 1 cut(s) 62
Sse9I AATT 3 cut(s) 156, 239, 276
SsiI CCGC 2 cut(s) 129, 233
SspMI CTAG 1 cut(s) 203
StyD4I CCNGG 1 cut(s) 259
TaaI ACNGT 1 cut(s) 103
TaqI TCGA 1 cut(s) 16
TasI AATT 3 cut(s) 156, 239, 276
TatI WGTACW 1 cut(s) 180
TfiI GAWTC 1 cut(s) 136
TseI GCWGC 1 cut(s) 126
VpaK11BI GGWCC 1 cut(s) 62
XapI RAATTY 2 cut(s) 239, 276
XspI CTAG 1 cut(s) 203
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.