Rw5G006490

Belongs to the yippee family

Basic Information

Type: gene
Biological Identity
rosa_wichuraiana
Chr5
Physical Location & Seq
Reverse (-)
6710910 .. 6713714
2805 bp
Loading structure...
UTR
Exon/CDS
Intron
Rw5G006490.1

Sequence Viewer

Length: 381 bp
ATGGGGAGGATTTTCCTGGTTGAATTGGAAGGCAGAACTTACAGATGCCAATACTGTGACAGCCCTCTTGCTCTGGCCGACGATGTCCTCTCTCGGTCTTTCAACTGCCGTCGAGGGAGGGCATATCTGTTCAGCAACGTGGTGAATATAACGCTTGGTCCTGAGGAAGAGAGGCTAATGCTTTCTGGTTTGCATACTGTAGAAGATATTTTTTGTGTCTGCTGCGGACAGATTCTTGGCTGGAAATATGTAATTGCACATGACAAAAACCAAAAGTACAAGGAAGGAAAGTTTGTGCTAGAGAGATGGAGGATAGAGGAGGATGTAGCAGAGGAATTCAATCTGGATACTCGCCCAGGTTCAAGTGATGAAATTCCTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

126

Amino Acids

14.58

Weight (kDa)

5.07

Isoelectric Point (pI)

50.07

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Yippee-Mis18 PF03226 14 - 106 2.3e-10 Yippee zinc-binding/DNA-binding /Mis18, centromere assembly
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 225
AcoI YGGCCR 1 cut(s) 75
AcsI RAATTY 2 cut(s) 335, 372
AfaI GTAC 1 cut(s) 278
AgsI TTSAA 4 cut(s) 23, 103, 340, 363
AjnI CCWGG 2 cut(s) 15, 355
AoxI GGCC 1 cut(s) 75
ApeKI GCWGC 1 cut(s) 222
ApoI RAATTY 2 cut(s) 335, 372
AspS9I GGNCC 1 cut(s) 158
AsuHPI GGTGA 1 cut(s) 154
AvaII GGWCC 1 cut(s) 158
AxyI CCTNAGG 1 cut(s) 162
BbvI GCAGC 1 cut(s) 209
BccI CCATC 1 cut(s) 300
BceAI ACGGC 1 cut(s) 93
BciT130I CCWGG 2 cut(s) 17, 357
BciVI GTATCC 1 cut(s) 340
BfaI CTAG 1 cut(s) 299
BfmI CTRYAG 1 cut(s) 198
BfuI GTATCC 1 cut(s) 340
BisI GCNGC 1 cut(s) 223
BlsI GCNGC 1 cut(s) 224
Bme1390I CCNGG 2 cut(s) 17, 357
Bme18I GGWCC 1 cut(s) 158
BmgT120I GGNCC 1 cut(s) 158
BmrFI CCNGG 2 cut(s) 17, 357
BmsI GCATC 1 cut(s) 35
BsaJI CCNNGG 1 cut(s) 355
Bse21I CCTNAGG 1 cut(s) 162
BseBI CCWGG 2 cut(s) 17, 357
BseDI CCNNGG 1 cut(s) 355
BseGI GGATG 1 cut(s) 328
BseMII CTCAG 1 cut(s) 153
BseRI GAGGAG 1 cut(s) 332
BseXI GCAGC 1 cut(s) 209
BshFI GGCC 1 cut(s) 77
BsnI GGCC 1 cut(s) 77
BspACI CCGC 1 cut(s) 225
BspANI GGCC 1 cut(s) 77
BspCNI CTCAG 1 cut(s) 154
BssECI CCNNGG 1 cut(s) 355
Bst2UI CCWGG 2 cut(s) 17, 357
Bst4CI ACNGT 2 cut(s) 56, 199
Bst6I CTCTTC 1 cut(s) 162
BstDEI CTNAG 1 cut(s) 162
BstF5I GGATG 1 cut(s) 328
BstNI CCWGG 2 cut(s) 17, 357
BstSCI CCNGG 2 cut(s) 15, 355
BstSFI CTRYAG 1 cut(s) 198
BstV1I GCAGC 1 cut(s) 209
Bsu36I CCTNAGG 1 cut(s) 162
BsuI GTATCC 1 cut(s) 340
BsuRI GGCC 1 cut(s) 77
BtsCI GGATG 1 cut(s) 328
Cfr13I GGNCC 1 cut(s) 158
Csp6I GTAC 1 cut(s) 277
CviAII CATG 1 cut(s) 260
CviJI RGCY 4 cut(s) 63, 77, 175, 240
CviKI_1 RGCY 4 cut(s) 63, 77, 175, 240
CviQI GTAC 1 cut(s) 277
DdeI CTNAG 1 cut(s) 162
EaeI YGGCCR 1 cut(s) 75
Eam1104I CTCTTC 1 cut(s) 162
EarI CTCTTC 1 cut(s) 162
Eco47I GGWCC 1 cut(s) 158
Eco81I CCTNAGG 1 cut(s) 162
EcoRI GAATTC 1 cut(s) 335
EcoRII CCWGG 2 cut(s) 15, 355
FaeI CATG 1 cut(s) 263
FaiI YATR 5 cut(s) 124, 149, 195, 249, 261
FatI CATG 1 cut(s) 259
Fnu4HI GCNGC 1 cut(s) 223
FokI GGATG 1 cut(s) 335
Fsp4HI GCNGC 1 cut(s) 223
FspBI CTAG 1 cut(s) 299
GluI GCNGC 1 cut(s) 223
HaeIII GGCC 1 cut(s) 77
Hin1II CATG 1 cut(s) 263
HinfI GANTC 1 cut(s) 232
HphI GGTGA 1 cut(s) 154
Hpy188III TCNNGA 2 cut(s) 161, 344
Hpy99I CGWCG 2 cut(s) 83, 114
HpyAV CCTTC 2 cut(s) 23, 278
HpyCH4III ACNGT 2 cut(s) 56, 199
HpyCH4IV ACGT 1 cut(s) 138
HpyCH4V TGCA 2 cut(s) 193, 257
HpyF3I CTNAG 1 cut(s) 162
HpySE526I ACGT 1 cut(s) 138
Hsp92II CATG 1 cut(s) 263
LpnPI CCDG 9 cut(s) 2, 29, 59, 171, 174, 226, 329, 342, 369
Lsp1109I GCAGC 1 cut(s) 209
LweI GCATC 1 cut(s) 35
MaeI CTAG 1 cut(s) 299
MaeII ACGT 1 cut(s) 138
MaeIII GTNAC 1 cut(s) 56
MboII GAAGA 2 cut(s) 179, 215
MluCI AATT 4 cut(s) 23, 252, 335, 372
MspR9I CCNGG 2 cut(s) 17, 357
MvaI CCWGG 2 cut(s) 17, 357
NlaIII CATG 1 cut(s) 263
NmuCI GTSAC 1 cut(s) 56
PfeI GAWTC 1 cut(s) 232
PflFI GACNNNGTC 1 cut(s) 83
PkrI GCNGC 1 cut(s) 224
Psp6I CCWGG 2 cut(s) 15, 355
PspGI CCWGG 2 cut(s) 15, 355
PspPI GGNCC 1 cut(s) 158
PsyI GACNNNGTC 1 cut(s) 83
RsaI GTAC 1 cut(s) 278
RsaNI GTAC 1 cut(s) 277
SatI GCNGC 1 cut(s) 223
Sau96I GGNCC 1 cut(s) 158
ScrFI CCNGG 2 cut(s) 17, 357
SetI ASST 2 cut(s) 141, 361
SfaNI GCATC 1 cut(s) 35
SfcI CTRYAG 1 cut(s) 198
SinI GGWCC 1 cut(s) 158
Sse9I AATT 4 cut(s) 23, 252, 335, 372
SsiI CCGC 1 cut(s) 225
SspMI CTAG 1 cut(s) 299
StyD4I CCNGG 2 cut(s) 15, 355
TaaI ACNGT 2 cut(s) 56, 199
TaiI ACGT 1 cut(s) 141
TaqI TCGA 1 cut(s) 112
TaqII GACCGA 1 cut(s) 84
TasI AATT 4 cut(s) 23, 252, 335, 372
TatI WGTACW 1 cut(s) 276
TfiI GAWTC 1 cut(s) 232
TseFI GTSAC 1 cut(s) 56
TseI GCWGC 1 cut(s) 222
Tsp45I GTSAC 1 cut(s) 56
Tth111I GACNNNGTC 1 cut(s) 83
VpaK11BI GGWCC 1 cut(s) 158
XapI RAATTY 2 cut(s) 335, 372
XspI CTAG 1 cut(s) 299
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.