Rh5CG077500

Belongs to the yippee family

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5C
Physical Location & Seq
Reverse (-)
5846816 .. 5850242
3427 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5CG077500.1

Sequence Viewer

Length: 291 bp
ATGGGGAGGATTTTCCTGGTTGAATTGGAAGGCAGAACTTACAGATGCCAATACTGTGACAGCCCTCTTGCTCTGGCCGACGATGTCCTCTCTCGGTCTTTCAACTGCCGTCGAGGGAGGGCATATCTGTTCAGCAATGTGGTGAATATAACGCTTGGTCCTGAGGAAGAGAGGCTAATGCTTTCTGGTTTGCATACTGTAGAAGATATTTTTTGTGTCTGCTGCGGACAGATTCTTGGCTGGAAATATGTATGCTTTCTTCATCTCTCTGCCTCATTTTTCCTGCTGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

96

Amino Acids

10.99

Weight (kDa)

6.05

Isoelectric Point (pI)

42.54

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Yippee-Mis18 PF03226 14 - 85 4.5e-06 Yippee zinc-binding/DNA-binding /Mis18, centromere assembly
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 225
AcoI YGGCCR 1 cut(s) 75
AgsI TTSAA 2 cut(s) 23, 103
AjnI CCWGG 1 cut(s) 15
AoxI GGCC 1 cut(s) 75
ApeKI GCWGC 1 cut(s) 222
AspS9I GGNCC 1 cut(s) 158
AsuHPI GGTGA 1 cut(s) 154
AvaII GGWCC 1 cut(s) 158
AxyI CCTNAGG 1 cut(s) 162
BarI GAAGNNNNNNTAC 2 cut(s) 243, 275
BbvI GCAGC 1 cut(s) 209
BceAI ACGGC 1 cut(s) 93
BciT130I CCWGG 1 cut(s) 17
BfmI CTRYAG 2 cut(s) 198, 287
BisI GCNGC 1 cut(s) 223
BlsI GCNGC 1 cut(s) 224
Bme1390I CCNGG 1 cut(s) 17
Bme18I GGWCC 1 cut(s) 158
BmgT120I GGNCC 1 cut(s) 158
BmrFI CCNGG 1 cut(s) 17
BmsI GCATC 1 cut(s) 35
Bse21I CCTNAGG 1 cut(s) 162
Bse3DI GCAATG 1 cut(s) 142
BseBI CCWGG 1 cut(s) 17
BseMI GCAATG 1 cut(s) 142
BseMII CTCAG 1 cut(s) 153
BseXI GCAGC 1 cut(s) 209
BshFI GGCC 1 cut(s) 77
BsnI GGCC 1 cut(s) 77
BspACI CCGC 1 cut(s) 225
BspANI GGCC 1 cut(s) 77
BspCNI CTCAG 1 cut(s) 154
BsrDI GCAATG 1 cut(s) 142
Bst2UI CCWGG 1 cut(s) 17
Bst4CI ACNGT 2 cut(s) 56, 199
Bst6I CTCTTC 1 cut(s) 162
BstDEI CTNAG 1 cut(s) 162
BstNI CCWGG 1 cut(s) 17
BstSCI CCNGG 1 cut(s) 15
BstSFI CTRYAG 2 cut(s) 198, 287
BstV1I GCAGC 1 cut(s) 209
Bsu36I CCTNAGG 1 cut(s) 162
BsuRI GGCC 1 cut(s) 77
Cfr13I GGNCC 1 cut(s) 158
CviJI RGCY 4 cut(s) 63, 77, 175, 240
CviKI_1 RGCY 4 cut(s) 63, 77, 175, 240
DdeI CTNAG 1 cut(s) 162
EaeI YGGCCR 1 cut(s) 75
Eam1104I CTCTTC 1 cut(s) 162
EarI CTCTTC 1 cut(s) 162
Eco47I GGWCC 1 cut(s) 158
Eco81I CCTNAGG 1 cut(s) 162
EcoRII CCWGG 1 cut(s) 15
FaiI YATR 5 cut(s) 124, 149, 195, 249, 253
Fnu4HI GCNGC 1 cut(s) 223
Fsp4HI GCNGC 1 cut(s) 223
GluI GCNGC 1 cut(s) 223
HaeIII GGCC 1 cut(s) 77
HinfI GANTC 1 cut(s) 232
HphI GGTGA 1 cut(s) 154
Hpy188III TCNNGA 1 cut(s) 161
Hpy99I CGWCG 2 cut(s) 83, 114
HpyAV CCTTC 1 cut(s) 23
HpyCH4III ACNGT 2 cut(s) 56, 199
HpyCH4V TGCA 1 cut(s) 193
HpyF3I CTNAG 1 cut(s) 162
LpnPI CCDG 6 cut(s) 2, 29, 59, 171, 174, 226
Lsp1109I GCAGC 1 cut(s) 209
LweI GCATC 1 cut(s) 35
MaeIII GTNAC 1 cut(s) 56
MboII GAAGA 3 cut(s) 179, 215, 251
MluCI AATT 1 cut(s) 23
MnlI CCTC 7 cut(s) 75, 98, 107, 111, 157, 165, 283
MspR9I CCNGG 1 cut(s) 17
MvaI CCWGG 1 cut(s) 17
NmuCI GTSAC 1 cut(s) 56
PfeI GAWTC 1 cut(s) 232
PflFI GACNNNGTC 1 cut(s) 83
PkrI GCNGC 1 cut(s) 224
Psp6I CCWGG 1 cut(s) 15
PspGI CCWGG 1 cut(s) 15
PspPI GGNCC 1 cut(s) 158
PsyI GACNNNGTC 1 cut(s) 83
SatI GCNGC 1 cut(s) 223
Sau96I GGNCC 1 cut(s) 158
ScrFI CCNGG 1 cut(s) 17
SfaNI GCATC 1 cut(s) 35
SfcI CTRYAG 2 cut(s) 198, 287
SinI GGWCC 1 cut(s) 158
Sse9I AATT 1 cut(s) 23
SsiI CCGC 1 cut(s) 225
StyD4I CCNGG 1 cut(s) 15
TaaI ACNGT 2 cut(s) 56, 199
TaqI TCGA 1 cut(s) 112
TaqII GACCGA 1 cut(s) 84
TasI AATT 1 cut(s) 23
TfiI GAWTC 1 cut(s) 232
TseFI GTSAC 1 cut(s) 56
TseI GCWGC 1 cut(s) 222
Tsp45I GTSAC 1 cut(s) 56
TspDTI ATGAA 1 cut(s) 251
Tth111I GACNNNGTC 1 cut(s) 83
VpaK11BI GGWCC 1 cut(s) 158
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.