Rmu_sc0000076.1_g000048
ERF Family

Belongs to the protein kinase superfamily

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000076.1
Physical Location & Seq
Forward (+)
212995 .. 215846
2852 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0000076.1_g000048.1.cds

Sequence Viewer

Length: 1014 bp
atggaggagaggtatgagccaatgaaggatcttgggtctggcaactttggggtggcgaggctggtcagagacaagaagaccaaggagcttgtggctgttaagtacatagagagagggaagaagattgatgagaatgttcagagggaaatcataaatcacagatccttgaggcatccaaatattgtcaggttcaaagaggtcttgttgactccaagtcatttagctattgtcatggaatatgcagctggtggtgaactctttgagaggatatgtagtgctggtagatttagtgaagatgaggcaagatttttctttcagcagctgatatctggagtcagctactgtcattccatggaaatttgtcacagggatctgaaactggaaaacacactcttggacggaagtgcaacaccacgtcttaaaatttgtgactttggatactccaagtctgctattttgcactcgcaaccaaaatcaactgtcggaacgcctgcatacattgctccggaggttctgtcacggaaggaatatgatggaaagattgcagatgtttggtcctgtggtgtgacactatatgtgatgttggttggagcatatccttttgaggatcctgaagatcctcgaaattttcgtaagaccattgagagaattatgagtgtccagtacaccatacccgactatgtacgtatttcagcagactgcaagcatctactttctcgtgtttttgttgccaacccttctaagaggatgagtcttcctgagataaaacagcacccctggtttctgaaaaatttggcgagagagctaattgaggttgagaaaaaaagctttgcagaagtggaacgtgaccacccaacacagagcattgaagaaataaataggatcatacaagatgcaaggacaccaggggaaggttccaaaggagttggccaagctgttgcaggagcaggaccatccgactctgatgatgtagatttggactcagaagttgatctcagtggtgactttgcttga

Protein Analysis

337

Amino Acids

38.07

Weight (kDa)

5.92

Isoelectric Point (pI)

36.27

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccIII TCCGGA 1 cut(s) 505
AclWI GGATC 7 cut(s) 36, 156, 378, 602, 611, 615, 890
AcoI YGGCCR 1 cut(s) 928
AcsI RAATTY 4 cut(s) 357, 423, 625, 790
AcuI CTGAAG 1 cut(s) 633
AfaI GTAC 3 cut(s) 104, 665, 684
AfiI CCNNNNNNNGG 1 cut(s) 911
AgsI TTSAA 2 cut(s) 193, 869
AhdI GACNNNNNGTC 1 cut(s) 213
AjiI CACGTC 1 cut(s) 416
AjnI CCWGG 2 cut(s) 776, 904
AluBI AGCT 8 cut(s) 88, 224, 245, 322, 339, 805, 828, 935
AluI AGCT 8 cut(s) 88, 224, 245, 322, 339, 805, 828, 935
Alw26I GTCTC 1 cut(s) 63
AlwI GGATC 7 cut(s) 36, 156, 378, 602, 611, 615, 890
AlwNI CAGNNNCTG 2 cut(s) 322, 342
Aor13HI TCCGGA 1 cut(s) 505
AoxI GGCC 1 cut(s) 928
ApeKI GCWGC 2 cut(s) 242, 319
ApoI RAATTY 4 cut(s) 357, 423, 625, 790
AspS9I GGNCC 2 cut(s) 555, 950
AsuHPI GGTGA 2 cut(s) 263, 1013
AvaII GGWCC 2 cut(s) 555, 950
BalI TGGCCA 1 cut(s) 930
BamHI GGATCC 1 cut(s) 607
BauI CACGAG 1 cut(s) 717
BbsI GAAGAC 2 cut(s) 83, 746
BbvI GCAGC 2 cut(s) 254, 331
BccI CCATC 2 cut(s) 527, 961
BciT130I CCWGG 2 cut(s) 778, 906
BciVI GTATCC 1 cut(s) 431
BcoDI GTCTC 1 cut(s) 63
BfuI GTATCC 1 cut(s) 431
BisI GCNGC 2 cut(s) 243, 320
BlsI GCNGC 2 cut(s) 244, 321
Bme1390I CCNGG 2 cut(s) 778, 906
Bme18I GGWCC 2 cut(s) 555, 950
BmeRI GACNNNNNGTC 1 cut(s) 213
BmgBI CACGTC 1 cut(s) 416
BmgT120I GGNCC 2 cut(s) 555, 950
BmiI GGNNCC 2 cut(s) 609, 916
BmrFI CCNGG 2 cut(s) 778, 906
BmsI GCATC 3 cut(s) 181, 715, 883
BpiI GAAGAC 2 cut(s) 83, 746
BpmI CTGGAG 1 cut(s) 351
BpuEI CTTGAG 1 cut(s) 187
BsaAI YACGTR 1 cut(s) 686
BsaJI CCNNGG 4 cut(s) 81, 351, 776, 905
BsaWI WCCGGW 1 cut(s) 505
BsaXI ACNNNNNCTCC 3 cut(s) 26, 500, 530
Bsc4I CCNNNNNNNGG 1 cut(s) 911
Bse1I ACTGG 2 cut(s) 384, 661
Bse3DI GCAATG 1 cut(s) 498
BseAI TCCGGA 1 cut(s) 505
BseBI CCWGG 2 cut(s) 778, 906
BseDI CCNNGG 4 cut(s) 81, 351, 776, 905
BseGI GGATG 3 cut(s) 172, 753, 953
BseLI CCNNNNNNNGG 1 cut(s) 911
BseMI GCAATG 1 cut(s) 498
BseMII CTCAG 3 cut(s) 750, 996, 1009
BseNI ACTGG 2 cut(s) 384, 661
BseRI GAGGAG 1 cut(s) 20
BseXI GCAGC 2 cut(s) 254, 331
BshFI GGCC 1 cut(s) 930
BsiSI CCGG 1 cut(s) 506
BslI CCNNNNNNNGG 1 cut(s) 911
BsmAI GTCTC 1 cut(s) 63
BsnI GGCC 1 cut(s) 930
Bsp13I TCCGGA 1 cut(s) 505
Bsp143I GATC 7 cut(s) 28, 161, 370, 607, 616, 882, 991
Bsp19I CCATGG 1 cut(s) 351
BspANI GGCC 1 cut(s) 930
BspCNI CTCAG 3 cut(s) 751, 995, 1008
BspEI TCCGGA 1 cut(s) 505
BspLI GGNNCC 2 cut(s) 609, 916
BspPI GGATC 7 cut(s) 36, 156, 378, 602, 611, 615, 890
BsrDI GCAATG 1 cut(s) 498
BsrI ACTGG 2 cut(s) 384, 661
BssECI CCNNGG 4 cut(s) 81, 351, 776, 905
BssMI GATC 7 cut(s) 28, 161, 370, 607, 616, 882, 991
BssSI CACGAG 1 cut(s) 717
BssT1I CCWWGG 2 cut(s) 81, 351
Bst2BI CACGAG 1 cut(s) 717
Bst2UI CCWGG 2 cut(s) 778, 906
Bst4CI ACNGT 2 cut(s) 344, 481
BstAPI GCANNNNNTGC 1 cut(s) 500
BstBAI YACGTR 1 cut(s) 686
BstC8I GCNNGC 2 cut(s) 492, 704
BstDEI CTNAG 4 cut(s) 741, 759, 982, 995
BstDSI CCRYGG 1 cut(s) 351
BstF5I GGATG 3 cut(s) 172, 753, 953
BstKTI GATC 7 cut(s) 31, 164, 373, 610, 619, 885, 994
BstMAI GTCTC 1 cut(s) 63
BstMBI GATC 7 cut(s) 28, 161, 370, 607, 616, 882, 991
BstMWI GCNNNNNNNGC 1 cut(s) 500
BstNI CCWGG 2 cut(s) 778, 906
BstSCI CCNGG 2 cut(s) 776, 904
BstSNI TACGTA 1 cut(s) 686
BstV1I GCAGC 2 cut(s) 254, 331
BstV2I GAAGAC 2 cut(s) 83, 746
BstX2I RGATCY 5 cut(s) 28, 161, 370, 607, 616
BstYI RGATCY 5 cut(s) 28, 161, 370, 607, 616
BsuI GTATCC 1 cut(s) 431
BsuRI GGCC 1 cut(s) 930
BtgI CCRYGG 1 cut(s) 351
BtrI CACGTC 1 cut(s) 416
BtsCI GGATG 3 cut(s) 172, 753, 953
BtsIMutI CAGTG 1 cut(s) 1003
Cac8I GCNNGC 2 cut(s) 492, 704
CaiI CAGNNNCTG 2 cut(s) 322, 342
Cfr13I GGNCC 2 cut(s) 555, 950
Csp6I GTAC 3 cut(s) 103, 664, 683
CviAII CATG 2 cut(s) 232, 352
CviQI GTAC 3 cut(s) 103, 664, 683
DdeI CTNAG 4 cut(s) 741, 759, 982, 995
DpnI GATC 7 cut(s) 30, 163, 372, 609, 618, 884, 993
DpnII GATC 7 cut(s) 28, 161, 370, 607, 616, 882, 991
DriI GACNNNNNGTC 1 cut(s) 213
EaeI YGGCCR 1 cut(s) 928
Eam1105I GACNNNNNGTC 1 cut(s) 213
Eco105I TACGTA 1 cut(s) 686
Eco130I CCWWGG 2 cut(s) 81, 351
Eco32I GATATC 1 cut(s) 327
Eco47I GGWCC 2 cut(s) 555, 950
Eco57I CTGAAG 1 cut(s) 633
EcoRII CCWGG 2 cut(s) 776, 904
EcoRV GATATC 1 cut(s) 327
EcoT14I CCWWGG 2 cut(s) 81, 351
ErhI CCWWGG 2 cut(s) 81, 351
FaeI CATG 2 cut(s) 235, 355
FatI CATG 2 cut(s) 231, 351
Fnu4HI GCNGC 2 cut(s) 243, 320
FokI GGATG 3 cut(s) 159, 760, 940
Fsp4HI GCNGC 2 cut(s) 243, 320
GluI GCNGC 2 cut(s) 243, 320
GsuI CTGGAG 1 cut(s) 351
HaeIII GGCC 1 cut(s) 930
HapII CCGG 1 cut(s) 506
Hin1II CATG 2 cut(s) 235, 355
HincII GTYRAC 1 cut(s) 207
HindII GTYRAC 1 cut(s) 207
HindIII AAGCTT 1 cut(s) 826
HinfI GANTC 5 cut(s) 208, 333, 751, 959, 980
HpaII CCGG 1 cut(s) 506
HphI GGTGA 2 cut(s) 263, 1013
Hpy166II GTNNAC 3 cut(s) 207, 254, 666
Hpy188I TCNGA 8 cut(s) 68, 141, 375, 485, 786, 958, 964, 985
Hpy188III TCNNGA 4 cut(s) 330, 506, 611, 758
Hpy8I GTNNAC 3 cut(s) 207, 254, 666
HpyAV CCTTC 4 cut(s) 19, 517, 747, 905
HpyCH4III ACNGT 2 cut(s) 344, 481
HpyCH4IV ACGT 3 cut(s) 415, 685, 844
HpyCH4V TGCA 9 cut(s) 242, 407, 460, 494, 545, 702, 833, 896, 941
HpyF10VI GCNNNNNNNGC 1 cut(s) 500
HpyF3I CTNAG 4 cut(s) 741, 759, 982, 995
HpySE526I ACGT 3 cut(s) 415, 685, 844
Hsp92II CATG 2 cut(s) 235, 355
Kpn2I TCCGGA 1 cut(s) 505
Kzo9I GATC 7 cut(s) 28, 161, 370, 607, 616, 882, 991
LmnI GCTCC 4 cut(s) 85, 508, 590, 944
Lsp1109I GCAGC 2 cut(s) 254, 331
LweI GCATC 3 cut(s) 181, 715, 883
MaeII ACGT 3 cut(s) 415, 685, 844
MaeIII GTNAC 6 cut(s) 362, 428, 516, 565, 845, 1001
MalI GATC 7 cut(s) 30, 163, 372, 609, 618, 884, 993
MboI GATC 7 cut(s) 28, 161, 370, 607, 616, 882, 991
MboII GAAGA 7 cut(s) 88, 130, 133, 305, 626, 746, 881
MflI RGATCY 5 cut(s) 28, 161, 370, 607, 616
MlsI TGGCCA 1 cut(s) 930
MluCI AATT 6 cut(s) 357, 423, 625, 648, 790, 807
MluNI TGGCCA 1 cut(s) 930
MlyI GAGTC 5 cut(s) 202, 342, 760, 953, 974
MmeI TCCRAC 3 cut(s) 463, 568, 981
Mox20I TGGCCA 1 cut(s) 930
MroI TCCGGA 1 cut(s) 505
MscI TGGCCA 1 cut(s) 930
MseI TTAA 2 cut(s) 99, 420
Msp20I TGGCCA 1 cut(s) 930
MspA1I CMGCKG 2 cut(s) 245, 322
MspI CCGG 1 cut(s) 506
MspR9I CCNGG 2 cut(s) 778, 906
MvaI CCWGG 2 cut(s) 778, 906
MwoI GCNNNNNNNGC 1 cut(s) 500
NcoI CCATGG 1 cut(s) 351
NdeII GATC 7 cut(s) 28, 161, 370, 607, 616, 882, 991
NlaIII CATG 2 cut(s) 235, 355
NlaIV GGNNCC 2 cut(s) 609, 916
NmuCI GTSAC 6 cut(s) 362, 428, 516, 565, 845, 1001
PcsI WCGNNNNNNNCGW 1 cut(s) 628
PkrI GCNGC 2 cut(s) 244, 321
PleI GAGTC 5 cut(s) 202, 341, 759, 953, 974
PpsI GAGTC 5 cut(s) 202, 341, 759, 953, 974
Ppu21I YACGTR 1 cut(s) 686
Psp6I CCWGG 2 cut(s) 776, 904
PspGI CCWGG 2 cut(s) 776, 904
PspN4I GGNNCC 2 cut(s) 609, 916
PspPI GGNCC 2 cut(s) 555, 950
PstNI CAGNNNCTG 2 cut(s) 322, 342
PsuI RGATCY 5 cut(s) 28, 161, 370, 607, 616
PvuII CAGCTG 2 cut(s) 245, 322
RsaI GTAC 3 cut(s) 104, 665, 684
RsaNI GTAC 3 cut(s) 103, 664, 683
SaqAI TTAA 2 cut(s) 99, 420
SatI GCNGC 2 cut(s) 243, 320
Sau3AI GATC 7 cut(s) 28, 161, 370, 607, 616, 882, 991
Sau96I GGNCC 2 cut(s) 555, 950
SchI GAGTC 5 cut(s) 202, 342, 760, 953, 974
ScrFI CCNGG 2 cut(s) 778, 906
SfaNI GCATC 3 cut(s) 181, 715, 883
SinI GGWCC 2 cut(s) 555, 950
SmlI CTYRAG 1 cut(s) 166
SmoI CTYRAG 1 cut(s) 166
SnaBI TACGTA 1 cut(s) 686
Sse9I AATT 6 cut(s) 357, 423, 625, 648, 790, 807
SspI AATATT 1 cut(s) 181
StyD4I CCNGG 2 cut(s) 776, 904
StyI CCWWGG 2 cut(s) 81, 351
TaaI ACNGT 2 cut(s) 344, 481
TaiI ACGT 3 cut(s) 418, 688, 847
TaqI TCGA 1 cut(s) 622
TasI AATT 6 cut(s) 357, 423, 625, 648, 790, 807
TatI WGTACW 2 cut(s) 102, 663
Tru1I TTAA 2 cut(s) 99, 420
Tru9I TTAA 2 cut(s) 99, 420
TscAI CASTG 1 cut(s) 1003
TseFI GTSAC 6 cut(s) 362, 428, 516, 565, 845, 1001
TseI GCWGC 2 cut(s) 242, 319
Tsp45I GTSAC 6 cut(s) 362, 428, 516, 565, 845, 1001
TspDTI ATGAA 1 cut(s) 38
TspGWI ACGGA 2 cut(s) 414, 535
TspRI CASTG 1 cut(s) 1003
VpaK11BI GGWCC 2 cut(s) 555, 950
XapI RAATTY 4 cut(s) 357, 423, 625, 790
XcmI CCANNNNNNNNNTGG 1 cut(s) 88
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.