Rmu_sc0000192.1_g000025
ERF Family

Belongs to the class I-like SAM-binding methyltransferase superfamily. Erg6 SMT family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000192.1
OG0003004
Physical Location & Seq
Reverse (-)
121401 .. 125439
4039 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 666 bp
atgtcaaaatctggagcactggatctggcttctggggttggcgggaagcttgagaagcaccaagttctttcagctgtccacaaaaatggtctttggactcttagtcacattgatcaaagtatcttgcaggaactcaatcaccttgcaggagtggatgagacctgcaactttgtcaagtttgattgctacaaagaaatatatagagtgttgaagccaggacagtgttttgctgcttacgagtggtgcattactgattcctttgatcgaacaaactatgaacaccagcgaattaagggggaagttgagcttggcaatggacttcctgatatcagatcaaaagaacaatgtattcacgctctaaatgttgcaggttttgaggttatatgggaaaatgatgtttctgtgggttcaccgcttccttggtatatgccactagataaaagtcacatttcattgagtagcttccggcttacagctttggggcgtttcattactagaacaatggtcaaagccttagagtttttacgccttgcccctgagggtagccaaagagttcagtctttcctagagacaacagcagaagctcttgttgaaggtggaaggaaagggatcttcacaccaatgtacttcttcttggttcgaaagcctgaagctccaaacttgtaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko00100 ko01100 ko01110 ko01130 map00100 map01100 map01110 map01130
Pfam Domains
Protein Families
Methyltransf_11 Sterol_MT_C

Protein Analysis

221

Amino Acids

24.87

Weight (kDa)

6.39

Isoelectric Point (pI)

32.74

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Sterol_MT_C PF08498 153 - 217 6.6e-29 Sterol methyltransferase C-terminal
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 2 cut(s) 170, 359
AciI CCGC 2 cut(s) 42, 413
AclWI GGATC 2 cut(s) 30, 617
AfaI GTAC 1 cut(s) 626
AgsI TTSAA 2 cut(s) 211, 593
AhdI GACNNNNNGTC 1 cut(s) 102
AjnI CCWGG 1 cut(s) 214
AjuI GAANNNNNNNTTGG 2 cut(s) 291, 323
AluBI AGCT 7 cut(s) 49, 74, 307, 462, 476, 584, 653
AluI AGCT 7 cut(s) 49, 74, 307, 462, 476, 584, 653
Alw21I GWGCWC 1 cut(s) 19
Alw26I GTCTC 2 cut(s) 152, 563
AlwI GGATC 2 cut(s) 30, 617
ApeKI GCWGC 1 cut(s) 230
AsuHPI GGTGA 2 cut(s) 131, 402
AsuII TTCGAA 1 cut(s) 640
AxyI CCTNAGG 1 cut(s) 537
Bbv12I GWGCWC 1 cut(s) 19
BbvI GCAGC 1 cut(s) 217
BciT130I CCWGG 1 cut(s) 216
BclI TGATCA 1 cut(s) 112
BcoDI GTCTC 2 cut(s) 152, 563
BfaI CTAG 3 cut(s) 434, 495, 566
BfuAI ACCTGC 2 cut(s) 170, 359
BisI GCNGC 1 cut(s) 231
BlsI GCNGC 1 cut(s) 232
Bme1390I CCNGG 1 cut(s) 216
BmeRI GACNNNNNGTC 1 cut(s) 102
BmrFI CCNGG 1 cut(s) 216
BpmI CTGGAG 1 cut(s) 33
Bpu14I TTCGAA 1 cut(s) 640
BpuEI CTTGAG 1 cut(s) 71
BsaI GGTCTC 1 cut(s) 152
BsaJI CCNNGG 1 cut(s) 419
Bse1I ACTGG 1 cut(s) 24
Bse21I CCTNAGG 1 cut(s) 537
Bse3DI GCAATG 1 cut(s) 319
BseBI CCWGG 1 cut(s) 216
BseDI CCNNGG 1 cut(s) 419
BseGI GGATG 1 cut(s) 160
BseMI GCAATG 1 cut(s) 319
BseMII CTCAG 1 cut(s) 528
BseNI ACTGG 1 cut(s) 24
BseXI GCAGC 1 cut(s) 217
BsiHKAI GWGCWC 1 cut(s) 19
BsiSI CCGG 1 cut(s) 466
BsmAI GTCTC 2 cut(s) 152, 563
Bso31I GGTCTC 1 cut(s) 152
Bsp119I TTCGAA 1 cut(s) 640
Bsp1286I GDGCHC 1 cut(s) 19
Bsp143I GATC 5 cut(s) 22, 112, 262, 332, 609
BspACI CCGC 2 cut(s) 42, 413
BspCNI CTCAG 1 cut(s) 529
BspMI ACCTGC 2 cut(s) 170, 359
BspPI GGATC 2 cut(s) 30, 617
BspT104I TTCGAA 1 cut(s) 640
BspTNI GGTCTC 1 cut(s) 152
BsrDI GCAATG 1 cut(s) 319
BsrI ACTGG 1 cut(s) 24
BssECI CCNNGG 1 cut(s) 419
BssMI GATC 5 cut(s) 22, 112, 262, 332, 609
BssT1I CCWWGG 1 cut(s) 419
Bst2UI CCWGG 1 cut(s) 216
Bst4CI ACNGT 1 cut(s) 222
BstBI TTCGAA 1 cut(s) 640
BstDEI CTNAG 3 cut(s) 101, 514, 537
BstF5I GGATG 1 cut(s) 160
BstKTI GATC 5 cut(s) 25, 115, 265, 335, 612
BstMAI GTCTC 2 cut(s) 152, 563
BstMBI GATC 5 cut(s) 22, 112, 262, 332, 609
BstMWI GCNNNNNNNGC 1 cut(s) 55
BstNI CCWGG 1 cut(s) 216
BstSCI CCNGG 1 cut(s) 214
BstV1I GCAGC 1 cut(s) 217
BstX2I RGATCY 2 cut(s) 22, 609
BstXI CCANNNNNNTGG 1 cut(s) 86
BstYI RGATCY 2 cut(s) 22, 609
Bsu36I CCTNAGG 1 cut(s) 537
BtsCI GGATG 1 cut(s) 160
BtsIMutI CAGTG 2 cut(s) 17, 227
BveI ACCTGC 2 cut(s) 170, 359
Csp6I GTAC 1 cut(s) 625
CviQI GTAC 1 cut(s) 625
DdeI CTNAG 3 cut(s) 101, 514, 537
DpnI GATC 5 cut(s) 24, 114, 264, 334, 611
DpnII GATC 5 cut(s) 22, 112, 262, 332, 609
DriI GACNNNNNGTC 1 cut(s) 102
Eam1105I GACNNNNNGTC 1 cut(s) 102
Eco130I CCWWGG 1 cut(s) 419
Eco31I GGTCTC 1 cut(s) 152
Eco32I GATATC 1 cut(s) 328
Eco81I CCTNAGG 1 cut(s) 537
EcoRII CCWGG 1 cut(s) 214
EcoRV GATATC 1 cut(s) 328
EcoT14I CCWWGG 1 cut(s) 419
ErhI CCWWGG 1 cut(s) 419
FaiI YATR 7 cut(s) 199, 201, 276, 383, 385, 426, 428
FalI AAGNNNNNCTT 2 cut(s) 291, 323
FauI CCCGC 1 cut(s) 35
FbaI TGATCA 1 cut(s) 112
Fnu4HI GCNGC 1 cut(s) 231
FokI GGATG 1 cut(s) 167
Fsp4HI GCNGC 1 cut(s) 231
FspBI CTAG 3 cut(s) 434, 495, 566
GluI GCNGC 1 cut(s) 231
GsuI CTGGAG 1 cut(s) 33
HapII CCGG 1 cut(s) 466
HindIII AAGCTT 1 cut(s) 47
HinfI GANTC 2 cut(s) 97, 254
HpaII CCGG 1 cut(s) 466
HphI GGTGA 2 cut(s) 131, 402
Hpy166II GTNNAC 2 cut(s) 79, 410
Hpy188I TCNGA 1 cut(s) 332
Hpy188III TCNNGA 2 cut(s) 12, 323
Hpy8I GTNNAC 2 cut(s) 79, 410
HpyAV CCTTC 2 cut(s) 587, 594
HpyCH4III ACNGT 1 cut(s) 222
HpyCH4V TGCA 5 cut(s) 127, 146, 165, 246, 368
HpyF10VI GCNNNNNNNGC 1 cut(s) 55
HpyF3I CTNAG 3 cut(s) 101, 514, 537
Ksp22I TGATCA 1 cut(s) 112
Kzo9I GATC 5 cut(s) 22, 112, 262, 332, 609
LmnI GCTCC 2 cut(s) 14, 658
Lsp1109I GCAGC 1 cut(s) 217
MaeI CTAG 3 cut(s) 434, 495, 566
MaeIII GTNAC 2 cut(s) 104, 443
MalI GATC 5 cut(s) 24, 114, 264, 334, 611
MboI GATC 5 cut(s) 22, 112, 262, 332, 609
MboII GAAGA 2 cut(s) 604, 622
MflI RGATCY 2 cut(s) 22, 609
MhlI GDGCHC 1 cut(s) 19
MluCI AATT 1 cut(s) 288
MlyI GAGTC 1 cut(s) 91
MnlI CCTC 2 cut(s) 370, 532
MseI TTAA 1 cut(s) 291
MslI CAYNNNNRTG 2 cut(s) 84, 620
MspA1I CMGCKG 1 cut(s) 74
MspI CCGG 1 cut(s) 466
MspR9I CCNGG 1 cut(s) 216
MvaI CCWGG 1 cut(s) 216
MwoI GCNNNNNNNGC 1 cut(s) 55
NdeII GATC 5 cut(s) 22, 112, 262, 332, 609
NmuCI GTSAC 2 cut(s) 104, 443
NspV TTCGAA 1 cut(s) 640
PfeI GAWTC 1 cut(s) 254
PkrI GCNGC 1 cut(s) 232
PleI GAGTC 1 cut(s) 91
PpsI GAGTC 1 cut(s) 91
Psp6I CCWGG 1 cut(s) 214
PspGI CCWGG 1 cut(s) 214
PsuI RGATCY 2 cut(s) 22, 609
PvuII CAGCTG 1 cut(s) 74
RsaI GTAC 1 cut(s) 626
RsaNI GTAC 1 cut(s) 625
RseI CAYNNNNRTG 2 cut(s) 84, 620
SaqAI TTAA 1 cut(s) 291
SatI GCNGC 1 cut(s) 231
Sau3AI GATC 5 cut(s) 22, 112, 262, 332, 609
SchI GAGTC 1 cut(s) 91
ScrFI CCNGG 1 cut(s) 216
SduI GDGCHC 1 cut(s) 19
SfuI TTCGAA 1 cut(s) 640
SmiMI CAYNNNNRTG 2 cut(s) 84, 620
SmlI CTYRAG 1 cut(s) 50
SmoI CTYRAG 1 cut(s) 50
Sse9I AATT 1 cut(s) 288
SsiI CCGC 2 cut(s) 42, 413
SspMI CTAG 3 cut(s) 434, 495, 566
StyD4I CCNGG 1 cut(s) 214
StyI CCWWGG 1 cut(s) 419
TaaI ACNGT 1 cut(s) 222
TaqI TCGA 2 cut(s) 265, 640
TasI AATT 1 cut(s) 288
TatI WGTACW 1 cut(s) 624
TfiI GAWTC 1 cut(s) 254
Tru1I TTAA 1 cut(s) 291
Tru9I TTAA 1 cut(s) 291
TscAI CASTG 2 cut(s) 24, 227
TseFI GTSAC 2 cut(s) 104, 443
TseI GCWGC 1 cut(s) 230
Tsp45I GTSAC 2 cut(s) 104, 443
TspDTI ATGAA 3 cut(s) 291, 441, 478
TspRI CASTG 2 cut(s) 24, 227
XspI CTAG 3 cut(s) 434, 495, 566
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.