Rmu_sc0000255.1_g000002

cell fate commitment

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000255.1
Physical Location & Seq
Forward (+)
4812 .. 6044
1233 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0000255.1_g000002.1.cds

Sequence Viewer

Length: 615 bp
atggcagtagtggaggacttgtttcacatgggaggaactcaggatactgcagcagctggggaaatagatgacattaagagactagtggtctttaccaaggaaaacaccaacactgccgccctatttggacctcgacctggtcggaagctgttgcagtcatctgatggagatggagatggagatggatcagatgaaaatggggatgaagaaggatcagatggagatggagatggagatggggatggatcagatggaaatggaaatggaaatggagatggatcagatgggggtgacatgaatcgagttgggaaagcatgctcaaaggacgacataacaatcttccaaggggaaacggctccactcccgagtggaattccggcttacacagttcagatcctcaacacttgcgtctcaggttgcagcatctctgacattcacatcaactgtggatggtttagctccgcccgccttgtcaatcctagagtcttcaggcgcatggactacaacgactgcctagtcaatgatggtcagcctcttggccctggacaaaccctctctttccaatatgccaatagctttcgttaccctctttctgtttcgtctgtagcttgttag

Protein Analysis

204

Amino Acids

21.3

Weight (kDa)

4.14

Isoelectric Point (pI)

30.97

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0010768)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 515
AciI CCGC 3 cut(s) 117, 462, 466
AclWI GGATC 5 cut(s) 193, 220, 253, 286, 388
AcsI RAATTY 1 cut(s) 372
AcuI CTGAAG 1 cut(s) 472
AfiI CCNNNNNNNGG 1 cut(s) 137
AhdI GACNNNNNGTC 1 cut(s) 86
AhlI ACTAGT 1 cut(s) 82
AjnI CCWGG 2 cut(s) 136, 541
AluBI AGCT 5 cut(s) 56, 148, 459, 576, 608
AluI AGCT 5 cut(s) 56, 148, 459, 576, 608
Alw26I GTCTC 2 cut(s) 73, 415
AlwI GGATC 5 cut(s) 193, 220, 253, 286, 388
AlwNI CAGNNNCTG 1 cut(s) 56
Ama87I CYCGRG 1 cut(s) 364
AoxI GGCC 1 cut(s) 538
ApeKI GCWGC 3 cut(s) 50, 53, 420
ApoI RAATTY 1 cut(s) 372
AspLEI GCGC 1 cut(s) 495
AspS9I GGNCC 2 cut(s) 128, 539
AsuHPI GGTGA 1 cut(s) 302
AvaI CYCGRG 1 cut(s) 364
AvaII GGWCC 1 cut(s) 128
BbsI GAAGAC 1 cut(s) 478
BbvI GCAGC 3 cut(s) 62, 65, 432
BceAI ACGGC 1 cut(s) 369
BciT130I CCWGG 2 cut(s) 138, 543
BciVI GTATCC 1 cut(s) 37
BcoDI GTCTC 2 cut(s) 73, 415
BcuI ACTAGT 1 cut(s) 82
BfaI CTAG 3 cut(s) 83, 480, 515
BfmI CTRYAG 2 cut(s) 48, 603
BfuI GTATCC 1 cut(s) 37
BisI GCNGC 4 cut(s) 51, 54, 117, 421
BlsI GCNGC 4 cut(s) 52, 55, 118, 422
Bme1390I CCNGG 2 cut(s) 138, 543
Bme18I GGWCC 1 cut(s) 128
BmeRI GACNNNNNGTC 1 cut(s) 86
BmeT110I CYCGRG 1 cut(s) 364
BmgT120I GGNCC 2 cut(s) 128, 539
BmiI GGNNCC 1 cut(s) 357
BmrFI CCNGG 2 cut(s) 138, 543
BmsI GCATC 1 cut(s) 432
BpiI GAAGAC 1 cut(s) 478
BsaJI CCNNGG 3 cut(s) 96, 343, 541
BsaXI ACNNNNNCTCC 2 cut(s) 5, 35
Bsc4I CCNNNNNNNGG 1 cut(s) 137
BseBI CCWGG 2 cut(s) 138, 543
BseDI CCNNGG 3 cut(s) 96, 343, 541
BseGI GGATG 3 cut(s) 208, 247, 455
BseLI CCNNNNNNNGG 1 cut(s) 137
BseMII CTCAG 2 cut(s) 53, 426
BseXI GCAGC 3 cut(s) 62, 65, 432
BseYI CCCAGC 1 cut(s) 56
BshFI GGCC 1 cut(s) 540
BsiHKCI CYCGRG 1 cut(s) 364
BsiSI CCGG 1 cut(s) 377
BslI CCNNNNNNNGG 1 cut(s) 137
BsmAI GTCTC 2 cut(s) 73, 415
BsmBI CGTCTC 1 cut(s) 415
BsnI GGCC 1 cut(s) 540
BsoBI CYCGRG 1 cut(s) 364
Bsp143I GATC 5 cut(s) 185, 212, 245, 278, 393
BspACI CCGC 3 cut(s) 117, 462, 466
BspANI GGCC 1 cut(s) 540
BspCNI CTCAG 2 cut(s) 52, 425
BspLI GGNNCC 1 cut(s) 357
BspMAI CTGCAG 1 cut(s) 52
BspPI GGATC 5 cut(s) 193, 220, 253, 286, 388
BssECI CCNNGG 3 cut(s) 96, 343, 541
BssMI GATC 5 cut(s) 185, 212, 245, 278, 393
BssT1I CCWWGG 2 cut(s) 96, 343
Bst2UI CCWGG 2 cut(s) 138, 543
Bst4CI ACNGT 2 cut(s) 388, 446
BstC8I GCNNGC 2 cut(s) 316, 466
BstDEI CTNAG 2 cut(s) 39, 412
BstF5I GGATG 3 cut(s) 208, 247, 455
BstHHI GCGC 1 cut(s) 495
BstKTI GATC 5 cut(s) 188, 215, 248, 281, 396
BstMAI GTCTC 2 cut(s) 73, 415
BstMBI GATC 5 cut(s) 185, 212, 245, 278, 393
BstMWI GCNNNNNNNGC 1 cut(s) 465
BstNI CCWGG 2 cut(s) 138, 543
BstNSI RCATGY 1 cut(s) 318
BstSCI CCNGG 2 cut(s) 136, 541
BstSFI CTRYAG 2 cut(s) 48, 603
BstV1I GCAGC 3 cut(s) 62, 65, 432
BstV2I GAAGAC 1 cut(s) 478
BstX2I RGATCY 1 cut(s) 393
BstYI RGATCY 1 cut(s) 393
BsuI GTATCC 1 cut(s) 37
BsuRI GGCC 1 cut(s) 540
BtsCI GGATG 3 cut(s) 208, 247, 455
BtsI GCAGTG 1 cut(s) 111
BtsIMutI CAGTG 1 cut(s) 111
Cac8I GCNNGC 2 cut(s) 316, 466
CaiI CAGNNNCTG 1 cut(s) 56
CfoI GCGC 1 cut(s) 495
Cfr13I GGNCC 2 cut(s) 128, 539
CseI GACGC 1 cut(s) 397
CsiI ACCWGGT 1 cut(s) 136
CviAII CATG 4 cut(s) 28, 295, 315, 496
CviJI RGCY 9 cut(s) 56, 148, 356, 380, 459, 532, 540, 576, 608
CviKI_1 RGCY 9 cut(s) 56, 148, 356, 380, 459, 532, 540, 576, 608
DdeI CTNAG 2 cut(s) 39, 412
DpnI GATC 5 cut(s) 187, 214, 247, 280, 395
DpnII GATC 5 cut(s) 185, 212, 245, 278, 393
DrdI GACNNNNNNGTC 1 cut(s) 515
DriI GACNNNNNGTC 1 cut(s) 86
DseDI GACNNNNNNGTC 1 cut(s) 515
Eam1105I GACNNNNNGTC 1 cut(s) 86
EciI GGCGGA 1 cut(s) 451
Eco130I CCWWGG 2 cut(s) 96, 343
Eco47I GGWCC 1 cut(s) 128
Eco57I CTGAAG 1 cut(s) 472
Eco88I CYCGRG 1 cut(s) 364
EcoRI GAATTC 1 cut(s) 372
EcoRII CCWGG 2 cut(s) 136, 541
EcoT14I CCWWGG 2 cut(s) 96, 343
ErhI CCWWGG 2 cut(s) 96, 343
Esp3I CGTCTC 1 cut(s) 415
FaeI CATG 4 cut(s) 31, 298, 318, 499
FaiI YATR 6 cut(s) 29, 296, 316, 332, 497, 567
FatI CATG 4 cut(s) 27, 294, 314, 495
FauI CCCGC 1 cut(s) 473
Fnu4HI GCNGC 4 cut(s) 51, 54, 117, 421
FokI GGATG 3 cut(s) 215, 254, 462
Fsp4HI GCNGC 4 cut(s) 51, 54, 117, 421
FspBI CTAG 3 cut(s) 83, 480, 515
GlaI GCGC 1 cut(s) 494
GluI GCNGC 4 cut(s) 51, 54, 117, 421
GsaI CCCAGC 1 cut(s) 60
HaeIII GGCC 1 cut(s) 540
HapII CCGG 1 cut(s) 377
HgaI GACGC 1 cut(s) 397
HhaI GCGC 1 cut(s) 495
Hin1II CATG 4 cut(s) 31, 298, 318, 499
Hin6I GCGC 1 cut(s) 493
HinP1I GCGC 1 cut(s) 493
HinfI GANTC 2 cut(s) 298, 483
HpaII CCGG 1 cut(s) 377
HphI GGTGA 1 cut(s) 302
Hpy188I TCNGA 8 cut(s) 144, 163, 190, 217, 250, 283, 393, 430
Hpy188III TCNNGA 2 cut(s) 41, 364
HpyAV CCTTC 1 cut(s) 203
HpyCH4III ACNGT 2 cut(s) 388, 446
HpyCH4V TGCA 3 cut(s) 50, 154, 420
HpyF10VI GCNNNNNNNGC 1 cut(s) 465
HpyF3I CTNAG 2 cut(s) 39, 412
Hsp92II CATG 4 cut(s) 31, 298, 318, 499
HspAI GCGC 1 cut(s) 493
Kzo9I GATC 5 cut(s) 185, 212, 245, 278, 393
LmnI GCTCC 2 cut(s) 361, 464
LpnPI CCDG 9 cut(s) 26, 42, 123, 150, 390, 399, 475, 528, 555
Lsp1109I GCAGC 3 cut(s) 62, 65, 432
LweI GCATC 1 cut(s) 432
MabI ACCWGGT 1 cut(s) 136
MaeI CTAG 3 cut(s) 83, 480, 515
MaeIII GTNAC 2 cut(s) 290, 581
MalI GATC 5 cut(s) 187, 214, 247, 280, 395
MboI GATC 5 cut(s) 185, 212, 245, 278, 393
MboII GAAGA 3 cut(s) 218, 331, 478
MflI RGATCY 1 cut(s) 393
MluCI AATT 1 cut(s) 372
MlyI GAGTC 1 cut(s) 492
MmeI TCCRAC 1 cut(s) 122
MnlI CCTC 7 cut(s) 7, 26, 141, 407, 543, 563, 597
MseI TTAA 1 cut(s) 75
MspA1I CMGCKG 1 cut(s) 56
MspI CCGG 1 cut(s) 377
MspR9I CCNGG 2 cut(s) 138, 543
MvaI CCWGG 2 cut(s) 138, 543
MwoI GCNNNNNNNGC 1 cut(s) 465
NdeII GATC 5 cut(s) 185, 212, 245, 278, 393
NlaIII CATG 4 cut(s) 31, 298, 318, 499
NlaIV GGNNCC 1 cut(s) 357
NmuCI GTSAC 1 cut(s) 290
NspI RCATGY 1 cut(s) 318
PaeI GCATGC 1 cut(s) 318
PfeI GAWTC 1 cut(s) 298
PflFI GACNNNGTC 1 cut(s) 138
PkrI GCNGC 4 cut(s) 52, 55, 118, 422
PleI GAGTC 1 cut(s) 491
PpsI GAGTC 1 cut(s) 491
Psp6I CCWGG 2 cut(s) 136, 541
PspFI CCCAGC 1 cut(s) 56
PspGI CCWGG 2 cut(s) 136, 541
PspN4I GGNNCC 1 cut(s) 357
PspPI GGNCC 2 cut(s) 128, 539
PsrI GAACNNNNNNTAC 2 cut(s) 28, 60
PstI CTGCAG 1 cut(s) 52
PstNI CAGNNNCTG 1 cut(s) 56
PsuI RGATCY 1 cut(s) 393
PsyI GACNNNGTC 1 cut(s) 138
PvuII CAGCTG 1 cut(s) 56
SaqAI TTAA 1 cut(s) 75
SatI GCNGC 4 cut(s) 51, 54, 117, 421
Sau3AI GATC 5 cut(s) 185, 212, 245, 278, 393
Sau96I GGNCC 2 cut(s) 128, 539
SchI GAGTC 1 cut(s) 492
ScrFI CCNGG 2 cut(s) 138, 543
SetI ASST 8 cut(s) 58, 133, 139, 150, 418, 461, 578, 610
SexAI ACCWGGT 1 cut(s) 136
SfaNI GCATC 1 cut(s) 432
SfcI CTRYAG 2 cut(s) 48, 603
SinI GGWCC 1 cut(s) 128
SpeI ACTAGT 1 cut(s) 82
SphI GCATGC 1 cut(s) 318
Sse9I AATT 1 cut(s) 372
SsiI CCGC 3 cut(s) 117, 462, 466
SspMI CTAG 3 cut(s) 83, 480, 515
StyD4I CCNGG 2 cut(s) 136, 541
StyI CCWWGG 2 cut(s) 96, 343
TaaI ACNGT 2 cut(s) 388, 446
TaqI TCGA 2 cut(s) 133, 301
TasI AATT 1 cut(s) 372
TauI GCSGC 1 cut(s) 119
TfiI GAWTC 1 cut(s) 298
Tru1I TTAA 1 cut(s) 75
Tru9I TTAA 1 cut(s) 75
TscAI CASTG 1 cut(s) 118
TseFI GTSAC 1 cut(s) 290
TseI GCWGC 3 cut(s) 50, 53, 420
Tsp45I GTSAC 1 cut(s) 290
TspDTI ATGAA 3 cut(s) 207, 219, 311
TspRI CASTG 1 cut(s) 118
Tth111I GACNNNGTC 1 cut(s) 138
VpaK11BI GGWCC 1 cut(s) 128
XapI RAATTY 1 cut(s) 372
XceI RCATGY 1 cut(s) 318
XspI CTAG 3 cut(s) 83, 480, 515
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.