Rmu_sc0000321.1_g000009

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000321.1
OG0016955
Physical Location & Seq
Reverse (-)
40059 .. 40712
654 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0000321.1_g000009.1.cds

Sequence Viewer

Length: 393 bp
atgtctatgtggaccaggttgcagcctgcctatgctgcaaacatgtggaatgaggctctaaacaagagggtaggcactgaggtaattgtgcttcccttgtggttgctcagtattttcaagaatgaattggcacggattcgtgatgcgtacatgctaaagatttttgaggataaccagacccgtttgccaagttggtgtaacataggggatgaaaagctcccattatgccagatccttggtgaatatctgatggaactgcctgaatataacagcatagagccatatgcaaacatgaatgagcactgtgaatcacaaatacgacacgaagaggatttgctggacccagaacccatcttgaaagaacccagaaactgcagaagaagattggtatga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

130

Amino Acids

15.45

Weight (kDa)

5.09

Isoelectric Point (pI)

69.25

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 226
AfaI GTAC 1 cut(s) 149
AflIII ACRYGT 1 cut(s) 42
AgsI TTSAA 2 cut(s) 118, 358
AjnI CCWGG 1 cut(s) 14
AluBI AGCT 1 cut(s) 217
AluI AGCT 1 cut(s) 217
Alw21I GWGCWC 1 cut(s) 303
AlwI GGATC 1 cut(s) 226
AlwNI CAGNNNCTG 1 cut(s) 372
ApeKI GCWGC 2 cut(s) 22, 35
AspS9I GGNCC 2 cut(s) 12, 340
AsuHPI GGTGA 1 cut(s) 251
AvaII GGWCC 2 cut(s) 12, 340
BarI GAAGNNNNNNTAC 2 cut(s) 75, 107
Bbv12I GWGCWC 1 cut(s) 303
BbvI GCAGC 2 cut(s) 22, 34
BccI CCATC 2 cut(s) 244, 359
BciT130I CCWGG 1 cut(s) 16
BfmI CTRYAG 1 cut(s) 373
BisI GCNGC 2 cut(s) 23, 36
BlsI GCNGC 2 cut(s) 24, 37
Bme1390I CCNGG 1 cut(s) 16
Bme18I GGWCC 2 cut(s) 12, 340
BmgT120I GGNCC 2 cut(s) 12, 340
BmiI GGNNCC 1 cut(s) 342
BmrFI CCNGG 1 cut(s) 16
BmsI GCATC 1 cut(s) 133
BsaJI CCNNGG 1 cut(s) 235
BseBI CCWGG 1 cut(s) 16
BseDI CCNNGG 1 cut(s) 235
BseGI GGATG 1 cut(s) 214
BseMII CTCAG 2 cut(s) 69, 121
BseXI GCAGC 2 cut(s) 22, 34
BsiHKAI GWGCWC 1 cut(s) 303
Bsp1286I GDGCHC 1 cut(s) 303
Bsp143I GATC 1 cut(s) 231
BspCNI CTCAG 2 cut(s) 70, 120
BspLI GGNNCC 1 cut(s) 342
BspMAI CTGCAG 1 cut(s) 377
BspPI GGATC 1 cut(s) 226
BssECI CCNNGG 1 cut(s) 235
BssMI GATC 1 cut(s) 231
BssT1I CCWWGG 1 cut(s) 235
Bst2UI CCWGG 1 cut(s) 16
Bst4CI ACNGT 1 cut(s) 305
Bst6I CTCTTC 1 cut(s) 321
BstC8I GCNNGC 1 cut(s) 27
BstDEI CTNAG 2 cut(s) 78, 107
BstF5I GGATG 1 cut(s) 214
BstKTI GATC 1 cut(s) 234
BstMBI GATC 1 cut(s) 231
BstMWI GCNNNNNNNGC 1 cut(s) 35
BstNI CCWGG 1 cut(s) 16
BstNSI RCATGY 2 cut(s) 46, 154
BstSCI CCNGG 1 cut(s) 14
BstSFI CTRYAG 1 cut(s) 373
BstV1I GCAGC 2 cut(s) 22, 34
BstX2I RGATCY 1 cut(s) 231
BstXI CCANNNNNNTGG 1 cut(s) 236
BstYI RGATCY 1 cut(s) 231
BtsCI GGATG 1 cut(s) 214
BtsIMutI CAGTG 2 cut(s) 75, 301
Cac8I GCNNGC 1 cut(s) 27
CaiI CAGNNNCTG 1 cut(s) 372
Cfr13I GGNCC 2 cut(s) 12, 340
CsiI ACCWGGT 1 cut(s) 14
Csp6I GTAC 1 cut(s) 148
CviAII CATG 3 cut(s) 43, 151, 292
CviJI RGCY 4 cut(s) 25, 56, 217, 280
CviKI_1 RGCY 4 cut(s) 25, 56, 217, 280
CviQI GTAC 1 cut(s) 148
DdeI CTNAG 2 cut(s) 78, 107
DpnI GATC 1 cut(s) 233
DpnII GATC 1 cut(s) 231
Eam1104I CTCTTC 1 cut(s) 321
EarI CTCTTC 1 cut(s) 321
Eco130I CCWWGG 1 cut(s) 235
Eco47I GGWCC 2 cut(s) 12, 340
EcoRII CCWGG 1 cut(s) 14
EcoT14I CCWWGG 1 cut(s) 235
ErhI CCWWGG 1 cut(s) 235
FaeI CATG 3 cut(s) 46, 154, 295
FatI CATG 3 cut(s) 42, 150, 291
FauNDI CATATG 1 cut(s) 283
Fnu4HI GCNGC 2 cut(s) 23, 36
FokI GGATG 1 cut(s) 221
Fsp4HI GCNGC 2 cut(s) 23, 36
GluI GCNGC 2 cut(s) 23, 36
Hin1II CATG 3 cut(s) 46, 154, 295
HinfI GANTC 2 cut(s) 136, 308
HphI GGTGA 1 cut(s) 251
Hpy166II GTNNAC 1 cut(s) 12
Hpy188I TCNGA 1 cut(s) 249
Hpy188III TCNNGA 3 cut(s) 118, 140, 355
Hpy8I GTNNAC 1 cut(s) 12
HpyCH4III ACNGT 1 cut(s) 305
HpyCH4V TGCA 4 cut(s) 22, 38, 287, 375
HpyF10VI GCNNNNNNNGC 1 cut(s) 35
HpyF3I CTNAG 2 cut(s) 78, 107
Hsp92II CATG 3 cut(s) 46, 154, 295
Kzo9I GATC 1 cut(s) 231
LmnI GCTCC 1 cut(s) 222
LpnPI CCDG 8 cut(s) 28, 39, 188, 242, 273, 323, 357, 379
Lsp1109I GCAGC 2 cut(s) 22, 34
LweI GCATC 1 cut(s) 133
MabI ACCWGGT 1 cut(s) 14
MaeIII GTNAC 1 cut(s) 197
MalI GATC 1 cut(s) 233
MboI GATC 1 cut(s) 231
MboII GAAGA 3 cut(s) 338, 390, 393
MflI RGATCY 1 cut(s) 231
MhlI GDGCHC 1 cut(s) 303
MluCI AATT 2 cut(s) 84, 125
MnlI CCTC 5 cut(s) 46, 60, 73, 160, 322
MspR9I CCNGG 1 cut(s) 16
MvaI CCWGG 1 cut(s) 16
MwoI GCNNNNNNNGC 1 cut(s) 35
NdeI CATATG 1 cut(s) 283
NdeII GATC 1 cut(s) 231
NlaIII CATG 3 cut(s) 46, 154, 295
NlaIV GGNNCC 1 cut(s) 342
NspI RCATGY 2 cut(s) 46, 154
PciI ACATGT 1 cut(s) 42
PfeI GAWTC 2 cut(s) 136, 308
PkrI GCNGC 2 cut(s) 24, 37
PscI ACATGT 1 cut(s) 42
Psp6I CCWGG 1 cut(s) 14
PspGI CCWGG 1 cut(s) 14
PspN4I GGNNCC 1 cut(s) 342
PspPI GGNCC 2 cut(s) 12, 340
PstI CTGCAG 1 cut(s) 377
PstNI CAGNNNCTG 1 cut(s) 372
PsuI RGATCY 1 cut(s) 231
RsaI GTAC 1 cut(s) 149
RsaNI GTAC 1 cut(s) 148
SatI GCNGC 2 cut(s) 23, 36
Sau3AI GATC 1 cut(s) 231
Sau96I GGNCC 2 cut(s) 12, 340
ScrFI CCNGG 1 cut(s) 16
SduI GDGCHC 1 cut(s) 303
SetI ASST 3 cut(s) 20, 84, 219
SexAI ACCWGGT 1 cut(s) 14
SfaNI GCATC 1 cut(s) 133
SfcI CTRYAG 1 cut(s) 373
SinI GGWCC 2 cut(s) 12, 340
Sse9I AATT 2 cut(s) 84, 125
StyD4I CCNGG 1 cut(s) 14
StyI CCWWGG 1 cut(s) 235
TaaI ACNGT 1 cut(s) 305
TasI AATT 2 cut(s) 84, 125
TfiI GAWTC 2 cut(s) 136, 308
TscAI CASTG 2 cut(s) 82, 308
TseI GCWGC 2 cut(s) 22, 35
TspDTI ATGAA 3 cut(s) 138, 225, 308
TspGWI ACGGA 1 cut(s) 148
TspRI CASTG 2 cut(s) 82, 308
VpaK11BI GGWCC 2 cut(s) 12, 340
XceI RCATGY 2 cut(s) 46, 154
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.