Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0000331.1

Orthogroup ID

OG0013603

Physical Location & Seq

Genomic Coordinates Forward (+)

91503 .. 92033

Gene Structure 531 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0000331.1_g000017.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 531 bp

atgttccaagacttgagcgaattcatgagtttagaaaaagctgagattgagctagaccccgtggtgattgactttaacaatgtattcaagctgcttcatggtattcgaagtgctaaagtcgttctggatttatctgaaactaccatgaagtgtctgcacgagggagttttaacgccagaacgactgcaactacataatgtttgttgtttaagaattcgtggtttgagcttaatggacgatgatgtccccgctatggtctcccttttgaaaggaacgccaaacttggctactttgcacatagaggctggtcggactggaagcagatatagatcatcatcttatggcaatatgtcagtctgggagttgcaaaagcttgctttacataacctaaaggaggtgacaataaagctttccagtggaggtaatggaatcagctttacacagtatatcatccatcacgctctacagttgcagaaaatggttatctattatttacctgagcaatcttataaagtcaggaggtacaattaa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

F-box

Protein Analysis

176

Amino Acids

20.02

Weight (kDa)

7.77

Isoelectric Point (pI)

52.63

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0013603)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_2g04250
rosa_laevigata	RLG00000014989 RLG00000014994
rosa_multiflora	Rmu_sc0000331.1_g000017 Rmu_sc0001351.1_g000005 Rmu_sc0001351.1_g000011 Rmu_sc0006378.1_g000001 Rmu_sc0006378.1_g000002
rosa_roxburghii	Rroxscaffold_7G00211680
rosa_rugosa	Rorug05G0545400 Rorug05G0545400 Rorug05G0546100
rosa_samantha	Rh6AG061600 Rh6AG061700 Rh6BG055200 Rh6CG054700 Rh6DG052200 Rh6DG052700

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AanI	TTATAA	1 cut(s)	510
AasI	GACNNNNNNGTC	1 cut(s)	242
AciI	CCGC	1 cut(s)	249
AcsI	RAATTY	2 cut(s)	20, 213
AfaI	GTAC	1 cut(s)	524
AfiI	CCNNNNNNNGG	2 cut(s)	253, 394
AgsI	TTSAA	2 cut(s)	88, 268
AluBI	AGCT	7 cut(s)	41, 52, 91, 228, 373, 409, 435
AluI	AGCT	7 cut(s)	41, 52, 91, 228, 373, 409, 435
Alw26I	GTCTC	1 cut(s)	262
ApeKI	GCWGC	1 cut(s)	91
ApoI	RAATTY	2 cut(s)	20, 213
AsuHPI	GGTGA	2 cut(s)	76, 409
AsuII	TTCGAA	1 cut(s)	106
BauI	CACGAG	1 cut(s)	158
BbvI	GCAGC	1 cut(s)	78
BccI	CCATC	1 cut(s)	462
BcoDI	GTCTC	1 cut(s)	262
BfaI	CTAG	1 cut(s)	53
BfmI	CTRYAG	1 cut(s)	464
BisI	GCNGC	1 cut(s)	92
BlsI	GCNGC	1 cut(s)	93
Bpu10I	CCTNAGC	1 cut(s)	498
Bpu14I	TTCGAA	1 cut(s)	106
BpuEI	CTTGAG	1 cut(s)	34
BsaBI	GATNNNNATC	2 cut(s)	328, 334
BsaI	GGTCTC	1 cut(s)	262
BsaJI	CCNNGG	1 cut(s)	60
Bsc4I	CCNNNNNNNGG	2 cut(s)	253, 394
Bse1I	ACTGG	2 cut(s)	319, 414
Bse8I	GATNNNNATC	2 cut(s)	328, 334
BseDI	CCNNGG	1 cut(s)	60
BseGI	GGATG	1 cut(s)	450
BseJI	GATNNNNATC	2 cut(s)	328, 334
BseLI	CCNNNNNNNGG	2 cut(s)	253, 394
BseMII	CTCAG	2 cut(s)	33, 489
BseNI	ACTGG	2 cut(s)	319, 414
BseXI	GCAGC	1 cut(s)	78
BsgI	GTGCAG	1 cut(s)	140
BslFI	GGGAC	1 cut(s)	230
BslI	CCNNNNNNNGG	2 cut(s)	253, 394
BsmAI	GTCTC	1 cut(s)	262
BsmFI	GGGAC	1 cut(s)	230
Bso31I	GGTCTC	1 cut(s)	262
Bsp119I	TTCGAA	1 cut(s)	106
Bsp143I	GATC	1 cut(s)	329
BspACI	CCGC	1 cut(s)	249
BspCNI	CTCAG	2 cut(s)	34, 490
BspHI	TCATGA	1 cut(s)	24
BspT104I	TTCGAA	1 cut(s)	106
BspTNI	GGTCTC	1 cut(s)	262
BsrI	ACTGG	2 cut(s)	319, 414
BssECI	CCNNGG	1 cut(s)	60
BssMI	GATC	1 cut(s)	329
BssSI	CACGAG	1 cut(s)	158
Bst2BI	CACGAG	1 cut(s)	158
Bst4CI	ACNGT	2 cut(s)	444, 468
BstBI	TTCGAA	1 cut(s)	106
BstC8I	GCNNGC	1 cut(s)	375
BstDEI	CTNAG	2 cut(s)	42, 498
BstDSI	CCRYGG	1 cut(s)	60
BstENI	CCTNNNNNAGG	1 cut(s)	392
BstF5I	GGATG	1 cut(s)	450
BstKTI	GATC	1 cut(s)	332
BstMAI	GTCTC	1 cut(s)	262
BstMBI	GATC	1 cut(s)	329
BstSFI	CTRYAG	1 cut(s)	464
BstV1I	GCAGC	1 cut(s)	78
BtgI	CCRYGG	1 cut(s)	60
BtsCI	GGATG	1 cut(s)	450
BtsIMutI	CAGTG	1 cut(s)	421
Cac8I	GCNNGC	1 cut(s)	375
CciI	TCATGA	1 cut(s)	24
Csp6I	GTAC	1 cut(s)	523
CviAII	CATG	3 cut(s)	25, 98, 145
CviJI	RGCY	9 cut(s)	41, 52, 91, 228, 287, 305, 373, 409, 435
CviKI_1	RGCY	9 cut(s)	41, 52, 91, 228, 287, 305, 373, 409, 435
CviQI	GTAC	1 cut(s)	523
DdeI	CTNAG	2 cut(s)	42, 498
DpnI	GATC	1 cut(s)	331
DpnII	GATC	1 cut(s)	329
DrdI	GACNNNNNNGTC	1 cut(s)	242
DseDI	GACNNNNNNGTC	1 cut(s)	242
Eco31I	GGTCTC	1 cut(s)	262
EcoNI	CCTNNNNNAGG	1 cut(s)	392
EcoRI	GAATTC	2 cut(s)	20, 213
FaeI	CATG	3 cut(s)	28, 101, 148
FaqI	GGGAC	1 cut(s)	230
FatI	CATG	3 cut(s)	24, 97, 144
FauI	CCCGC	1 cut(s)	256
Fnu4HI	GCNGC	1 cut(s)	92
FokI	GGATG	1 cut(s)	437
Fsp4HI	GCNGC	1 cut(s)	92
FspBI	CTAG	1 cut(s)	53
GluI	GCNGC	1 cut(s)	92
Hin1II	CATG	3 cut(s)	28, 101, 148
HindIII	AAGCTT	2 cut(s)	371, 407
HinfI	GANTC	1 cut(s)	429
HphI	GGTGA	2 cut(s)	76, 409
Hpy188I	TCNGA	2 cut(s)	136, 312
Hpy188III	TCNNGA	3 cut(s)	25, 125, 517
HpyCH4III	ACNGT	2 cut(s)	444, 468
HpyCH4V	TGCA	5 cut(s)	157, 187, 295, 367, 472
HpyF3I	CTNAG	2 cut(s)	42, 498
Hsp92II	CATG	3 cut(s)	28, 101, 148
Kzo9I	GATC	1 cut(s)	329
LpnPI	CCDG	8 cut(s)	110, 189, 291, 300, 343, 427, 502, 510
Lsp1109I	GCAGC	1 cut(s)	78
MaeI	CTAG	1 cut(s)	53
MaeIII	GTNAC	1 cut(s)	397
MalI	GATC	1 cut(s)	331
MboI	GATC	1 cut(s)	329
MluCI	AATT	3 cut(s)	20, 213, 526
MmeI	TCCRAC	1 cut(s)	290
MnlI	CCTC	5 cut(s)	154, 295, 388, 413, 513
MseI	TTAA	5 cut(s)	75, 170, 209, 230, 529
NdeII	GATC	1 cut(s)	329
NlaIII	CATG	3 cut(s)	28, 101, 148
NmuCI	GTSAC	1 cut(s)	397
NspV	TTCGAA	1 cut(s)	106
PagI	TCATGA	1 cut(s)	24
PfeI	GAWTC	1 cut(s)	429
PkrI	GCNGC	1 cut(s)	93
PsiI	TTATAA	1 cut(s)	510
RsaI	GTAC	1 cut(s)	524
RsaNI	GTAC	1 cut(s)	523
SaqAI	TTAA	5 cut(s)	75, 170, 209, 230, 529
SatI	GCNGC	1 cut(s)	92
Sau3AI	GATC	1 cut(s)	329
SfcI	CTRYAG	1 cut(s)	464
SfuI	TTCGAA	1 cut(s)	106
SmlI	CTYRAG	1 cut(s)	13
SmoI	CTYRAG	1 cut(s)	13
Sse9I	AATT	3 cut(s)	20, 213, 526
SsiI	CCGC	1 cut(s)	249
SspMI	CTAG	1 cut(s)	53
TaaI	ACNGT	2 cut(s)	444, 468
TaqI	TCGA	1 cut(s)	106
TasI	AATT	3 cut(s)	20, 213, 526
TfiI	GAWTC	1 cut(s)	429
Tru1I	TTAA	5 cut(s)	75, 170, 209, 230, 529
Tru9I	TTAA	5 cut(s)	75, 170, 209, 230, 529
TscAI	CASTG	1 cut(s)	421
TseFI	GTSAC	1 cut(s)	397
TseI	GCWGC	1 cut(s)	91
Tsp45I	GTSAC	1 cut(s)	397
TspDTI	ATGAA	3 cut(s)	13, 86, 161
TspRI	CASTG	1 cut(s)	421
XagI	CCTNNNNNAGG	1 cut(s)	392
XapI	RAATTY	2 cut(s)	20, 213
XspI	CTAG	1 cut(s)	53

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.