Basic Information

Type: gene

Biological Identity

Species

rosa_samantha

Chromosome

Chr6A

Orthogroup ID

OG0013603

Physical Location & Seq

Genomic Coordinates Reverse (-)

9148305 .. 9148952

Gene Structure 648 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rh6AG061600.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 648 bp

ATGAGTCTAGAAAAAGCTGAGATTGAGCTAGATCCCGGGGTGAAGTTTGACGATGTATTCAATCTGTTTCATGGTATTCGAAGTGTTAAAGTTCTGGATTTATCCGAAAGGACCATGAAGTGTCTGTGCGAGGGGGATTTAACGGCAGAACAACTACAACTACATAATGTTTGTTGTTTAAGAATTCGTGGTTTAAGCTTAATGGATGACGATGTCCACGCTATGGTCTCCCTTTTAAAAAGAATGCCAAACTTGGCTACTTTGCGCATAGAGGCTGGCCGGACTGGAAGCAGATATAGATCATCATCTTATGGCAATATGTCAATCTGGGAGTTGCAAAAGCTTGCTTTACATAACCTAAAGGAGGTGACAATACAGCTTTCCAGTGGAAATAATGGAATCAGCTTTACACAATATCTCCTCCATCACGGTCTACAATTGCAGAAAATGGTCATCTATTATTTACCGGAGCAATCTTATGAAGTCAGAAGGCACAAATGGCCAAGGACTACGAATGCTAAAGTTGTCTTTCACGTGCGAGAAGATAAATATGAGAGCATAGATAATGTGTTTGATTTGCTTGATAGGGATGTTTATCCATCGGAACAAATATTGATTCAGAGATATGATCCCATCGCTAAAGTCTAA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

F-box

Protein Analysis

215

Amino Acids

24.93

Weight (kDa)

6.71

Isoelectric Point (pI)

50.99

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0013603)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_2g04250
rosa_laevigata	RLG00000014989 RLG00000014994
rosa_multiflora	Rmu_sc0000331.1_g000017 Rmu_sc0001351.1_g000005 Rmu_sc0001351.1_g000011 Rmu_sc0006378.1_g000001 Rmu_sc0006378.1_g000002
rosa_roxburghii	Rroxscaffold_7G00211680
rosa_rugosa	Rorug05G0545400 Rorug05G0545400 Rorug05G0546100
rosa_samantha	Rh6AG061600 Rh6AG061700 Rh6BG055200 Rh6CG054700 Rh6DG052200 Rh6DG052700

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
Acc16I	TGCGCA	1 cut(s)	266
AccB7I	CCANNNNNTGG	1 cut(s)	223
AccI	GTMKAC	1 cut(s)	433
AclWI	GGATC	2 cut(s)	26, 623
AcoI	YGGCCR	2 cut(s)	277, 500
AcsI	RAATTY	1 cut(s)	183
AcvI	CACGTG	1 cut(s)	535
AfiI	CCNNNNNNNGG	2 cut(s)	223, 364
AgsI	TTSAA	1 cut(s)	61
AluBI	AGCT	6 cut(s)	17, 28, 198, 343, 379, 405
AluI	AGCT	6 cut(s)	17, 28, 198, 343, 379, 405
Alw26I	GTCTC	1 cut(s)	232
AlwI	GGATC	2 cut(s)	26, 623
Ama87I	CYCGRG	1 cut(s)	35
AoxI	GGCC	2 cut(s)	277, 500
ApoI	RAATTY	1 cut(s)	183
AspLEI	GCGC	1 cut(s)	267
AspS9I	GGNCC	1 cut(s)	111
AsuC2I	CCSGG	2 cut(s)	36, 37
AsuHPI	GGTGA	2 cut(s)	52, 379
AsuII	TTCGAA	1 cut(s)	79
AvaI	CYCGRG	1 cut(s)	35
AvaII	GGWCC	1 cut(s)	111
BalI	TGGCCA	1 cut(s)	502
BbrPI	CACGTG	1 cut(s)	535
BccI	CCATC	3 cut(s)	432, 607, 641
BceAI	ACGGC	1 cut(s)	159
BcnI	CCSGG	2 cut(s)	36, 37
BcoDI	GTCTC	1 cut(s)	232
BfaI	CTAG	2 cut(s)	8, 29
Bme1390I	CCNGG	2 cut(s)	36, 37
Bme18I	GGWCC	1 cut(s)	111
BmeT110I	CYCGRG	1 cut(s)	35
BmgT120I	GGNCC	1 cut(s)	111
BmrFI	CCNGG	2 cut(s)	36, 37
Bpu14I	TTCGAA	1 cut(s)	79
BpuMI	CCSGG	2 cut(s)	36, 37
BsaAI	YACGTR	1 cut(s)	535
BsaBI	GATNNNNATC	3 cut(s)	298, 304, 594
BsaI	GGTCTC	1 cut(s)	232
BsaJI	CCNNGG	3 cut(s)	35, 36, 503
BsaWI	WCCGGW	1 cut(s)	466
BsaXI	ACNNNNNCTCC	2 cut(s)	402, 432
Bsc4I	CCNNNNNNNGG	2 cut(s)	223, 364
Bse1I	ACTGG	2 cut(s)	289, 384
Bse8I	GATNNNNATC	3 cut(s)	298, 304, 594
BseDI	CCNNGG	3 cut(s)	35, 36, 503
BseGI	GGATG	2 cut(s)	211, 595
BseJI	GATNNNNATC	3 cut(s)	298, 304, 594
BseLI	CCNNNNNNNGG	2 cut(s)	223, 364
BseMII	CTCAG	1 cut(s)	9
BseNI	ACTGG	2 cut(s)	289, 384
BseRI	GAGGAG	1 cut(s)	410
BshFI	GGCC	2 cut(s)	279, 502
BsiHKCI	CYCGRG	1 cut(s)	35
BsiSI	CCGG	3 cut(s)	36, 280, 467
BslI	CCNNNNNNNGG	2 cut(s)	223, 364
BsmAI	GTCTC	1 cut(s)	232
BsmI	GAATGC	2 cut(s)	249, 520
BsnI	GGCC	2 cut(s)	279, 502
Bso31I	GGTCTC	1 cut(s)	232
BsoBI	CYCGRG	1 cut(s)	35
Bsp119I	TTCGAA	1 cut(s)	79
Bsp143I	GATC	3 cut(s)	31, 299, 628
BspANI	GGCC	2 cut(s)	279, 502
BspCNI	CTCAG	1 cut(s)	10
BspPI	GGATC	2 cut(s)	26, 623
BspT104I	TTCGAA	1 cut(s)	79
BspTNI	GGTCTC	1 cut(s)	232
BsrI	ACTGG	2 cut(s)	289, 384
BssECI	CCNNGG	3 cut(s)	35, 36, 503
BssMI	GATC	3 cut(s)	31, 299, 628
BssT1I	CCWWGG	1 cut(s)	503
Bst4CI	ACNGT	1 cut(s)	431
BstBAI	YACGTR	1 cut(s)	535
BstBI	TTCGAA	1 cut(s)	79
BstC8I	GCNNGC	2 cut(s)	277, 345
BstDEI	CTNAG	1 cut(s)	18
BstENI	CCTNNNNNAGG	1 cut(s)	362
BstF5I	GGATG	2 cut(s)	211, 595
BstHHI	GCGC	1 cut(s)	267
BstKTI	GATC	3 cut(s)	34, 302, 631
BstMAI	GTCTC	1 cut(s)	232
BstMBI	GATC	3 cut(s)	31, 299, 628
BstMWI	GCNNNNNNNGC	1 cut(s)	499
BstSCI	CCNGG	2 cut(s)	34, 35
BstX2I	RGATCY	1 cut(s)	31
BstYI	RGATCY	1 cut(s)	31
BsuRI	GGCC	2 cut(s)	279, 502
BtgZI	GCGATG	1 cut(s)	619
BtsCI	GGATG	2 cut(s)	211, 595
BtsIMutI	CAGTG	1 cut(s)	391
Cac8I	GCNNGC	2 cut(s)	277, 345
CfoI	GCGC	1 cut(s)	267
Cfr13I	GGNCC	1 cut(s)	111
Cfr9I	CCCGGG	1 cut(s)	35
CviAII	CATG	2 cut(s)	71, 115
DdeI	CTNAG	1 cut(s)	18
DpnI	GATC	3 cut(s)	33, 301, 630
DpnII	GATC	3 cut(s)	31, 299, 628
DraI	TTTAAA	1 cut(s)	237
EaeI	YGGCCR	2 cut(s)	277, 500
Eco130I	CCWWGG	1 cut(s)	503
Eco31I	GGTCTC	1 cut(s)	232
Eco47I	GGWCC	1 cut(s)	111
Eco72I	CACGTG	1 cut(s)	535
Eco88I	CYCGRG	1 cut(s)	35
EcoNI	CCTNNNNNAGG	1 cut(s)	362
EcoRI	GAATTC	1 cut(s)	183
EcoT14I	CCWWGG	1 cut(s)	503
ErhI	CCWWGG	1 cut(s)	503
FaeI	CATG	2 cut(s)	74, 118
FatI	CATG	2 cut(s)	70, 114
FblI	GTMKAC	1 cut(s)	433
FokI	GGATG	2 cut(s)	218, 602
FspBI	CTAG	2 cut(s)	8, 29
FspI	TGCGCA	1 cut(s)	266
GlaI	GCGC	1 cut(s)	266
HaeIII	GGCC	2 cut(s)	279, 502
HapII	CCGG	3 cut(s)	36, 280, 467
HhaI	GCGC	1 cut(s)	267
Hin1II	CATG	2 cut(s)	74, 118
Hin6I	GCGC	1 cut(s)	265
HinP1I	GCGC	1 cut(s)	265
HindIII	AAGCTT	2 cut(s)	196, 341
HinfI	GANTC	3 cut(s)	4, 399, 616
HpaII	CCGG	3 cut(s)	36, 280, 467
HphI	GGTGA	2 cut(s)	52, 379
Hpy166II	GTNNAC	2 cut(s)	217, 434
Hpy188I	TCNGA	4 cut(s)	106, 488, 604, 621
Hpy188III	TCNNGA	2 cut(s)	8, 95
Hpy8I	GTNNAC	2 cut(s)	217, 434
HpyAV	CCTTC	1 cut(s)	483
HpyCH4III	ACNGT	1 cut(s)	431
HpyCH4IV	ACGT	1 cut(s)	534
HpyCH4V	TGCA	2 cut(s)	337, 442
HpyF10VI	GCNNNNNNNGC	1 cut(s)	499
HpyF3I	CTNAG	1 cut(s)	18
HpySE526I	ACGT	1 cut(s)	534
Hsp92II	CATG	2 cut(s)	74, 118
HspAI	GCGC	1 cut(s)	265
Kzo9I	GATC	3 cut(s)	31, 299, 628
LmnI	GCTCC	1 cut(s)	469
LpnPI	CCDG	8 cut(s)	49, 80, 261, 270, 293, 313, 397, 480
MaeI	CTAG	2 cut(s)	8, 29
MaeII	ACGT	1 cut(s)	534
MaeIII	GTNAC	1 cut(s)	367
MalI	GATC	3 cut(s)	33, 301, 630
MboI	GATC	3 cut(s)	31, 299, 628
MboII	GAAGA	1 cut(s)	554
MfeI	CAATTG	1 cut(s)	437
MflI	RGATCY	1 cut(s)	31
MlsI	TGGCCA	1 cut(s)	502
MluCI	AATT	2 cut(s)	183, 437
MluNI	TGGCCA	1 cut(s)	502
MlyI	GAGTC	1 cut(s)	13
MnlI	CCTC	4 cut(s)	124, 265, 358, 431
Mox20I	TGGCCA	1 cut(s)	502
MscI	TGGCCA	1 cut(s)	502
MseI	TTAA	6 cut(s)	87, 140, 179, 194, 200, 236
Msp20I	TGGCCA	1 cut(s)	502
MspI	CCGG	3 cut(s)	36, 280, 467
MspR9I	CCNGG	2 cut(s)	36, 37
MunI	CAATTG	1 cut(s)	437
Mva1269I	GAATGC	2 cut(s)	249, 520
MwoI	GCNNNNNNNGC	1 cut(s)	499
NciI	CCSGG	2 cut(s)	36, 37
NdeII	GATC	3 cut(s)	31, 299, 628
NlaIII	CATG	2 cut(s)	74, 118
NmuCI	GTSAC	1 cut(s)	367
NsbI	TGCGCA	1 cut(s)	266
NspV	TTCGAA	1 cut(s)	79
PctI	GAATGC	2 cut(s)	249, 520
PfeI	GAWTC	2 cut(s)	399, 616
PflFI	GACNNNGTC	1 cut(s)	212
PflMI	CCANNNNNTGG	1 cut(s)	223
PleI	GAGTC	1 cut(s)	12
PmaCI	CACGTG	1 cut(s)	535
PmlI	CACGTG	1 cut(s)	535
PpsI	GAGTC	1 cut(s)	12
Ppu21I	YACGTR	1 cut(s)	535
PspCI	CACGTG	1 cut(s)	535
PspPI	GGNCC	1 cut(s)	111
PsuI	RGATCY	1 cut(s)	31
PsyI	GACNNNGTC	1 cut(s)	212
SaqAI	TTAA	6 cut(s)	87, 140, 179, 194, 200, 236
Sau3AI	GATC	3 cut(s)	31, 299, 628
Sau96I	GGNCC	1 cut(s)	111
SchI	GAGTC	1 cut(s)	13
ScrFI	CCNGG	2 cut(s)	36, 37
SetI	ASST	9 cut(s)	19, 30, 200, 345, 360, 369, 381, 407, 537
SfuI	TTCGAA	1 cut(s)	79
SinI	GGWCC	1 cut(s)	111
SmaI	CCCGGG	1 cut(s)	37
Sse9I	AATT	2 cut(s)	183, 437
SspI	AATATT	1 cut(s)	612
SspMI	CTAG	2 cut(s)	8, 29
StyD4I	CCNGG	2 cut(s)	34, 35
StyI	CCWWGG	1 cut(s)	503
TaaI	ACNGT	1 cut(s)	431
TaiI	ACGT	1 cut(s)	537
TaqI	TCGA	1 cut(s)	79
TasI	AATT	2 cut(s)	183, 437
TfiI	GAWTC	2 cut(s)	399, 616
Tru1I	TTAA	6 cut(s)	87, 140, 179, 194, 200, 236
Tru9I	TTAA	6 cut(s)	87, 140, 179, 194, 200, 236
TscAI	CASTG	1 cut(s)	391
TseFI	GTSAC	1 cut(s)	367
Tsp45I	GTSAC	1 cut(s)	367
TspDTI	ATGAA	3 cut(s)	59, 131, 495
TspMI	CCCGGG	1 cut(s)	35
TspRI	CASTG	1 cut(s)	391
Tth111I	GACNNNGTC	1 cut(s)	212
Van91I	CCANNNNNTGG	1 cut(s)	223
VpaK11BI	GGWCC	1 cut(s)	111
XagI	CCTNNNNNAGG	1 cut(s)	362
XapI	RAATTY	1 cut(s)	183
XbaI	TCTAGA	1 cut(s)	7
XmaI	CCCGGG	1 cut(s)	35
XmiI	GTMKAC	1 cut(s)	433
XspI	CTAG	2 cut(s)	8, 29

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.