Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0000353.1

Orthogroup ID

OG0005818

Physical Location & Seq

Genomic Coordinates Forward (+)

107096 .. 113449

Gene Structure 6354 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0000353.1_g000027.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 1536 bp

atggaatatgcgcacgcacattatgaggatgattcgggattcatgcgcatatctccccagtggtacactacatcaatacattggctcacactcggtccacctcttccagctgttgccagcaggttttggctggcattaaagttgctttggcttactactgaaaaatttatgagtccccagagtacattgaatccttgtagagccctagagggcatgcatggggtacatgtggtgcctagttcacggttcgaatcagaagagactactcaagatggggactttgctcactcaacttgtacaagttcggctattggaacaaatttgtctatgcagcgagtatggcagcacacaccaccatgtttgaagcctattcagggttgcattcacggcgatcgtaacctcgcagaaacagctgttaatgtgctcacttcacttcctttcatagttcttgggatccatgccccaaggaagaatctaaacaccaagctatatgctaattcattaattggagttggagttgcctcgagtttatatcattgttcaagaggaaaactaaggaaatatatgagatgggctgactatacaatgatagctacagcaacagtatgtctctcaagagcactcagaaatgaaaacccaaaattgctcatggcagcttctgcagtatttctacctatccagcctctgatggtttcagctgttcatactggaatgatggaggtagcgtttgccaaaagagcgttaaaagatccagagctaaggatggcacacaatgtgcataagatgtcgtcattattgggtggtgtactttttattgcagatgatgtgtttcccagaactccataccttcatgctgcatggcatcttgctgcagctgtaggtgttagcacctgcaataagcttctctaccttcaaatcccagaaatctctgccacccaccttgaagctctcaactctaggaatctagaaccggcggcgccaccccaagcaccagctaggaaaataccgaatcggccactagaagatgcagaaaatcctctgtctgcatccatagaaaaattggcagaaaagaaaaaagaaaaagaaaaaaaaaaggcagcccaagcagaagcccgagctgcaactcaagcccagaagcccaagccactgacgtcactgccctctgccacgtcattcgccaacgtcaacaacgtcagcaccggcaacagtcaccgccagcgacttttccgaccagttttccggcgacctatttcgagcttttgtgatttcaagtcagttcttgactacaactcggaagcacttcgcattaaattcttgatggaattttgtggtaaagacatcatagatgcgatgttgattgaaaagactctctctaccttcctcgtctttgcattgatagttgctaagaactatcgaatagatgttgctgcaggacggatcacaaggtttcataagctcattggagctatgaatattgctaaaaagtatgacaacattcttgtgaagcactataaatcgagatccgaggaaatatag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

511

Amino Acids

56.94

Weight (kDa)

9.54

Isoelectric Point (pI)

48.07

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0005818)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G23110 AT1G23110 AT1G23110 AT1G23110 AT1G23110 AT1G23110 AT1G23110 AT1G70900
fragaria_vesca	FvH4_4g32670
malus_domestica	MD13G1023800.v1.1 MD16G1026500.v1.1
prunus_persica	Prupe.1G326900_v2.0.a1
pyrus_communis	pycom13g02220 pycom16g02230
rosa_chinensis	RchiOBHm_Chr4g0441581
rosa_laevigata	RLG00000006083
rosa_multiflora	Rmu_sc0000353.1_g000027
rosa_roxburghii	Rroxscaffold_5G00382420
rosa_rugosa	Rorug04G0334700 Rorug04G0334700 Rorug04G0334700 Rorug04G0334700 Rorug04G0334800
rosa_samantha	Rh4AG386100 Rh4BG400300 Rh4CG415200 Rh4DG393000
rosa_wichuraiana	Rw4G033350

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AarI	CACCTGC	1 cut(s)	899
AatII	GACGTC	1 cut(s)	1154
Acc16I	TGCGCA	2 cut(s)	12, 47
Acc36I	ACCTGC	2 cut(s)	111, 899
AccB1I	GGYRCC	2 cut(s)	232, 976
AciI	CCGC	2 cut(s)	974, 1213
AclWI	GGATC	5 cut(s)	448, 461, 743, 1445, 1515
AcoI	YGGCCR	1 cut(s)	1013
AcsI	RAATTY	4 cut(s)	164, 319, 1310, 1322
AcyI	GRCGYC	2 cut(s)	977, 1151
AdeI	CACNNNGTG	1 cut(s)	775
AfaI	GTAC	5 cut(s)	65, 184, 225, 298, 807
AfiI	CCNNNNNNNGG	1 cut(s)	374
AflIII	ACRYGT	1 cut(s)	226
AgsI	TTSAA	7 cut(s)	190, 364, 543, 914, 944, 1270, 1361
AjiI	CACGTC	1 cut(s)	1170
Alw21I	GWGCWC	2 cut(s)	426, 622
Alw26I	GTCTC	2 cut(s)	254, 614
AlwI	GGATC	5 cut(s)	448, 461, 743, 1445, 1515
AlwNI	CAGNNNCTG	2 cut(s)	659, 685
Ama87I	CYCGRG	2 cut(s)	523, 1113
AoxI	GGCC	1 cut(s)	1013
ApeKI	GCWGC	9 cut(s)	331, 343, 653, 854, 869, 872, 1097, 1118, 1427
ApoI	RAATTY	4 cut(s)	164, 319, 1310, 1322
AseI	ATTAAT	1 cut(s)	503
Asp700I	GAANNNNTTC	1 cut(s)	1299
AspLEI	GCGC	3 cut(s)	13, 48, 979
AspS9I	GGNCC	1 cut(s)	95
AsuHPI	GGTGA	1 cut(s)	1202
AsuII	TTCGAA	1 cut(s)	249
AvaI	CYCGRG	2 cut(s)	523, 1113
AvaII	GGWCC	1 cut(s)	95
BamHI	GGATCC	1 cut(s)	453
BanI	GGYRCC	2 cut(s)	232, 976
BanII	GRGCYC	1 cut(s)	205
Bbv12I	GWGCWC	2 cut(s)	426, 622
BbvI	GCAGC	9 cut(s)	343, 355, 665, 841, 856, 884, 1105, 1109, 1414
BccI	CCATC	6 cut(s)	266, 564, 682, 709, 757, 1312
BceAI	ACGGC	1 cut(s)	403
BcoDI	GTCTC	2 cut(s)	254, 614
BfaI	CTAG	6 cut(s)	206, 237, 957, 965, 996, 1019
BfmI	CTRYAG	5 cut(s)	594, 660, 870, 876, 1428
BfoI	RGCGCY	1 cut(s)	980
BfuAI	ACCTGC	2 cut(s)	111, 899
Bme18I	GGWCC	1 cut(s)	95
BmeT110I	CYCGRG	2 cut(s)	523, 1113
BmgBI	CACGTC	1 cut(s)	1170
BmgT120I	GGNCC	1 cut(s)	95
BmiI	GGNNCC	3 cut(s)	234, 455, 978
BmrI	ACTGGG	1 cut(s)	52
BmsI	GCATC	4 cut(s)	871, 1015, 1055, 1336
BmuI	ACTGGG	1 cut(s)	52
Bpu10I	CCTNAGC	1 cut(s)	758
Bpu14I	TTCGAA	1 cut(s)	249
BpuEI	CTTGAG	3 cut(s)	252, 598, 1110
BsaHI	GRCGYC	2 cut(s)	977, 1151
BsaJI	CCNNGG	2 cut(s)	464, 1524
BsaXI	ACNNNNNCTCC	4 cut(s)	501, 531, 710, 740
Bsc4I	CCNNNNNNNGG	1 cut(s)	374
Bse118I	RCCGGY	2 cut(s)	970, 1199
Bse1I	ACTGG	3 cut(s)	58, 712, 1232
BseDI	CCNNGG	2 cut(s)	464, 1524
BseGI	GGATG	3 cut(s)	34, 768, 1046
BseLI	CCNNNNNNNGG	1 cut(s)	374
BseMII	CTCAG	1 cut(s)	637
BseNI	ACTGG	3 cut(s)	58, 712, 1232
BseXI	GCAGC	9 cut(s)	343, 355, 665, 841, 856, 884, 1105, 1109, 1414
Bsh1285I	CGRYCG	1 cut(s)	394
BshFI	GGCC	1 cut(s)	1015
BshNI	GGYRCC	2 cut(s)	232, 976
BsiEI	CGRYCG	1 cut(s)	394
BsiHKAI	GWGCWC	2 cut(s)	426, 622
BsiHKCI	CYCGRG	2 cut(s)	523, 1113
BsiSI	CCGG	3 cut(s)	971, 1200, 1240
BslFI	GGGAC	2 cut(s)	159, 290
BslI	CCNNNNNNNGG	1 cut(s)	374
BsmAI	GTCTC	2 cut(s)	254, 614
BsmFI	GGGAC	2 cut(s)	159, 290
BsmI	GAATGC	1 cut(s)	381
BsnI	GGCC	1 cut(s)	1015
BsoBI	CYCGRG	2 cut(s)	523, 1113
Bsp119I	TTCGAA	1 cut(s)	249
Bsp1286I	GDGCHC	3 cut(s)	205, 426, 622
Bsp1407I	TGTACA	1 cut(s)	296
Bsp143I	GATC	5 cut(s)	391, 453, 748, 1437, 1520
BspACI	CCGC	2 cut(s)	974, 1213
BspANI	GGCC	1 cut(s)	1015
BspCNI	CTCAG	1 cut(s)	636
BspLI	GGNNCC	3 cut(s)	234, 455, 978
BspMAI	CTGCAG	3 cut(s)	664, 874, 1432
BspMI	ACCTGC	2 cut(s)	111, 899
BspPI	GGATC	5 cut(s)	448, 461, 743, 1445, 1515
BspT104I	TTCGAA	1 cut(s)	249
BspT107I	GGYRCC	2 cut(s)	232, 976
BsrFI	RCCGGY	2 cut(s)	970, 1199
BsrGI	TGTACA	1 cut(s)	296
BsrI	ACTGG	3 cut(s)	58, 712, 1232
BssAI	RCCGGY	2 cut(s)	970, 1199
BssECI	CCNNGG	2 cut(s)	464, 1524
BssMI	GATC	5 cut(s)	391, 453, 748, 1437, 1520
BssNI	GRCGYC	2 cut(s)	977, 1151
BssT1I	CCWWGG	1 cut(s)	464
Bst4CI	ACNGT	3 cut(s)	246, 604, 1208
Bst6I	CTCTTC	2 cut(s)	108, 252
BstACI	GRCGYC	2 cut(s)	977, 1151
BstAPI	GCANNNNNTGC	1 cut(s)	659
BstAUI	TGTACA	1 cut(s)	296
BstBI	TTCGAA	1 cut(s)	249
BstC8I	GCNNGC	5 cut(s)	15, 118, 132, 215, 1217
BstDEI	CTNAG	4 cut(s)	554, 623, 758, 1404
BstF5I	GGATG	3 cut(s)	34, 768, 1046
BstH2I	RGCGCY	1 cut(s)	980
BstHHI	GCGC	3 cut(s)	13, 48, 979
BstKTI	GATC	5 cut(s)	394, 456, 751, 1440, 1523
BstMAI	GTCTC	2 cut(s)	254, 614
BstMBI	GATC	5 cut(s)	391, 453, 748, 1437, 1520
BstMCI	CGRYCG	1 cut(s)	394
BstMWI	GCNNNNNNNGC	8 cut(s)	340, 387, 410, 659, 737, 1103, 1118, 1127
BstNSI	RCATGY	2 cut(s)	217, 230
BstSFI	CTRYAG	5 cut(s)	594, 660, 870, 876, 1428
BstV1I	GCAGC	9 cut(s)	343, 355, 665, 841, 856, 884, 1105, 1109, 1414
BstX2I	RGATCY	3 cut(s)	453, 748, 1520
BstYI	RGATCY	3 cut(s)	453, 748, 1520
BsuRI	GGCC	1 cut(s)	1015
BtgZI	GCGATG	1 cut(s)	1364
BtrI	CACGTC	1 cut(s)	1170
BtsCI	GGATG	3 cut(s)	34, 768, 1046
BtsI	GCAGTG	1 cut(s)	1154
BtsIMutI	CAGTG	3 cut(s)	65, 1145, 1154
BveI	ACCTGC	2 cut(s)	111, 899
Cac8I	GCNNGC	5 cut(s)	15, 118, 132, 215, 1217
CaiI	CAGNNNCTG	2 cut(s)	659, 685
CfoI	GCGC	3 cut(s)	13, 48, 979
Cfr10I	RCCGGY	2 cut(s)	970, 1199
Cfr13I	GGNCC	1 cut(s)	95
Csp6I	GTAC	5 cut(s)	64, 183, 224, 297, 806
CspCI	CAANNNNNGTGG	4 cut(s)	342, 377, 922, 957
CviAII	CATG	9 cut(s)	43, 214, 218, 227, 357, 458, 649, 851, 858
CviQI	GTAC	5 cut(s)	64, 183, 224, 297, 806
DdeI	CTNAG	4 cut(s)	554, 623, 758, 1404
DinI	GGCGCC	1 cut(s)	978
DpnI	GATC	5 cut(s)	393, 455, 750, 1439, 1522
DpnII	GATC	5 cut(s)	391, 453, 748, 1437, 1520
DraIII	CACNNNGTG	1 cut(s)	775
EaeI	YGGCCR	1 cut(s)	1013
Eam1104I	CTCTTC	2 cut(s)	108, 252
EarI	CTCTTC	2 cut(s)	108, 252
Eco130I	CCWWGG	1 cut(s)	464
Eco24I	GRGCYC	1 cut(s)	205
Eco47I	GGWCC	1 cut(s)	95
Eco88I	CYCGRG	2 cut(s)	523, 1113
EcoT14I	CCWWGG	1 cut(s)	464
EcoT22I	ATGCAT	1 cut(s)	219
EcoT38I	GRGCYC	1 cut(s)	205
EgeI	GGCGCC	1 cut(s)	978
EheI	GGCGCC	1 cut(s)	978
ErhI	CCWWGG	1 cut(s)	464
FaeI	CATG	9 cut(s)	46, 217, 221, 230, 360, 461, 652, 854, 861
FaqI	GGGAC	2 cut(s)	159, 290
FatI	CATG	9 cut(s)	42, 213, 217, 226, 356, 457, 648, 850, 857
FokI	GGATG	3 cut(s)	41, 775, 1033
FriOI	GRGCYC	1 cut(s)	205
FspAI	RTGCGCAY	2 cut(s)	12, 47
FspBI	CTAG	6 cut(s)	206, 237, 957, 965, 996, 1019
FspI	TGCGCA	2 cut(s)	12, 47
GlaI	GCGC	3 cut(s)	12, 47, 978
HaeII	RGCGCY	1 cut(s)	980
HaeIII	GGCC	1 cut(s)	1015
HapII	CCGG	3 cut(s)	971, 1200, 1240
HhaI	GCGC	3 cut(s)	13, 48, 979
Hin1I	GRCGYC	2 cut(s)	977, 1151
Hin1II	CATG	9 cut(s)	46, 217, 221, 230, 360, 461, 652, 854, 861
Hin6I	GCGC	3 cut(s)	11, 46, 977
HinP1I	GCGC	3 cut(s)	11, 46, 977
HincII	GTYRAC	1 cut(s)	1186
HindII	GTYRAC	1 cut(s)	1186
HindIII	AAGCTT	1 cut(s)	899
HinfI	GANTC	9 cut(s)	32, 39, 172, 190, 251, 472, 961, 1009, 1366
HpaII	CCGG	3 cut(s)	971, 1200, 1240
HphI	GGTGA	1 cut(s)	1202
Hpy166II	GTNNAC	5 cut(s)	66, 98, 242, 806, 1186
Hpy188I	TCNGA	6 cut(s)	256, 626, 687, 1229, 1294, 1525
Hpy188III	TCNNGA	9 cut(s)	36, 269, 543, 615, 752, 965, 1280, 1315, 1518
Hpy8I	GTNNAC	5 cut(s)	66, 98, 242, 806, 1186
HpyAV	CCTTC	3 cut(s)	857, 920, 1387
HpyCH4III	ACNGT	3 cut(s)	246, 604, 1208
HpyCH4IV	ACGT	4 cut(s)	1151, 1169, 1182, 1191
HpyF10VI	GCNNNNNNNGC	8 cut(s)	340, 387, 410, 659, 737, 1103, 1118, 1127
HpyF3I	CTNAG	4 cut(s)	554, 623, 758, 1404
HpySE526I	ACGT	4 cut(s)	1151, 1169, 1182, 1191
Hsp92I	GRCGYC	2 cut(s)	977, 1151
Hsp92II	CATG	9 cut(s)	46, 217, 221, 230, 360, 461, 652, 854, 861
HspAI	GCGC	3 cut(s)	11, 46, 977
KasI	GGCGCC	1 cut(s)	976
Kzo9I	GATC	5 cut(s)	391, 453, 748, 1437, 1520
LmnI	GCTCC	1 cut(s)	1463
Lsp1109I	GCAGC	9 cut(s)	343, 355, 665, 841, 856, 884, 1105, 1109, 1414
LweI	GCATC	4 cut(s)	871, 1015, 1055, 1336
MaeI	CTAG	6 cut(s)	206, 237, 957, 965, 996, 1019
MaeII	ACGT	4 cut(s)	1151, 1169, 1182, 1191
MaeIII	GTNAC	3 cut(s)	395, 1152, 1208
MalI	GATC	5 cut(s)	393, 455, 750, 1439, 1522
MboI	GATC	5 cut(s)	391, 453, 748, 1437, 1520
MboII	GAAGA	4 cut(s)	95, 269, 481, 1034
MflI	RGATCY	3 cut(s)	453, 748, 1520
MhlI	GDGCHC	3 cut(s)	205, 426, 622
MluCI	AATT	8 cut(s)	164, 319, 496, 504, 641, 1058, 1310, 1322
Mly113I	GGCGCC	1 cut(s)	977
MlyI	GAGTC	2 cut(s)	181, 1360
MmeI	TCCRAC	2 cut(s)	493, 1252
Mph1103I	ATGCAT	1 cut(s)	219
MroXI	GAANNNNTTC	1 cut(s)	1299
MseI	TTAA	5 cut(s)	137, 417, 503, 743, 1308
MslI	CAYNNNNRTG	2 cut(s)	355, 1499
MspA1I	CMGCKG	4 cut(s)	110, 413, 698, 875
MspI	CCGG	3 cut(s)	971, 1200, 1240
Mva1269I	GAATGC	1 cut(s)	381
MwoI	GCNNNNNNNGC	8 cut(s)	340, 387, 410, 659, 737, 1103, 1118, 1127
NarI	GGCGCC	1 cut(s)	977
NdeII	GATC	5 cut(s)	391, 453, 748, 1437, 1520
NlaIII	CATG	9 cut(s)	46, 217, 221, 230, 360, 461, 652, 854, 861
NlaIV	GGNNCC	3 cut(s)	234, 455, 978
NmuCI	GTSAC	2 cut(s)	1152, 1208
NsbI	TGCGCA	2 cut(s)	12, 47
NsiI	ATGCAT	1 cut(s)	219
NspI	RCATGY	2 cut(s)	217, 230
NspV	TTCGAA	1 cut(s)	249
PaeI	GCATGC	1 cut(s)	217
PaeR7I	CTCGAG	1 cut(s)	523
PaqCI	CACCTGC	1 cut(s)	899
PciI	ACATGT	1 cut(s)	226
PcsI	WCGNNNNNNNCGW	1 cut(s)	1188
PctI	GAATGC	1 cut(s)	381
PdmI	GAANNNNTTC	1 cut(s)	1299
PfeI	GAWTC	7 cut(s)	32, 39, 190, 251, 472, 961, 1009
Ple19I	CGATCG	1 cut(s)	394
PleI	GAGTC	2 cut(s)	180, 1360
PluTI	GGCGCC	1 cut(s)	980
PpsI	GAGTC	2 cut(s)	180, 1360
PscI	ACATGT	1 cut(s)	226
PshBI	ATTAAT	1 cut(s)	503
PspN4I	GGNNCC	3 cut(s)	234, 455, 978
PspPI	GGNCC	1 cut(s)	95
PspXI	VCTCGAGB	1 cut(s)	523
PstI	CTGCAG	3 cut(s)	664, 874, 1432
PstNI	CAGNNNCTG	2 cut(s)	659, 685
PsuI	RGATCY	3 cut(s)	453, 748, 1520
PvuI	CGATCG	1 cut(s)	394
PvuII	CAGCTG	4 cut(s)	110, 413, 698, 875
RsaI	GTAC	5 cut(s)	65, 184, 225, 298, 807
RsaNI	GTAC	5 cut(s)	64, 183, 224, 297, 806
RseI	CAYNNNNRTG	2 cut(s)	355, 1499
SaqAI	TTAA	5 cut(s)	137, 417, 503, 743, 1308
Sau3AI	GATC	5 cut(s)	391, 453, 748, 1437, 1520
Sau96I	GGNCC	1 cut(s)	95
SchI	GAGTC	2 cut(s)	181, 1360
SduI	GDGCHC	3 cut(s)	205, 426, 622
SfaNI	GCATC	4 cut(s)	871, 1015, 1055, 1336
SfcI	CTRYAG	5 cut(s)	594, 660, 870, 876, 1428
SfoI	GGCGCC	1 cut(s)	978
Sfr274I	CTCGAG	1 cut(s)	523
SfuI	TTCGAA	1 cut(s)	249
SinI	GGWCC	1 cut(s)	95
SlaI	CTCGAG	1 cut(s)	523
SmiMI	CAYNNNNRTG	2 cut(s)	355, 1499
SmlI	CTYRAG	4 cut(s)	267, 523, 613, 1125
SmoI	CTYRAG	4 cut(s)	267, 523, 613, 1125
SphI	GCATGC	1 cut(s)	217
Sse9I	AATT	8 cut(s)	164, 319, 496, 504, 641, 1058, 1310, 1322
SsiI	CCGC	2 cut(s)	974, 1213
SspDI	GGCGCC	1 cut(s)	976
SspI	AATATT	1 cut(s)	1474
SspMI	CTAG	6 cut(s)	206, 237, 957, 965, 996, 1019
StyI	CCWWGG	1 cut(s)	464
TaaI	ACNGT	3 cut(s)	246, 604, 1208
TaiI	ACGT	4 cut(s)	1154, 1172, 1185, 1194
TaqI	TCGA	5 cut(s)	249, 524, 1253, 1414, 1517
TaqII	GACCGA	1 cut(s)	83
TasI	AATT	8 cut(s)	164, 319, 496, 504, 641, 1058, 1310, 1322
TatI	WGTACW	3 cut(s)	182, 296, 805
TauI	GCSGC	1 cut(s)	977
TfiI	GAWTC	7 cut(s)	32, 39, 190, 251, 472, 961, 1009
Tru1I	TTAA	5 cut(s)	137, 417, 503, 743, 1308
Tru9I	TTAA	5 cut(s)	137, 417, 503, 743, 1308
TscAI	CASTG	3 cut(s)	65, 1152, 1161
TseFI	GTSAC	2 cut(s)	1152, 1208
TseI	GCWGC	9 cut(s)	331, 343, 653, 854, 869, 872, 1097, 1118, 1427
Tsp45I	GTSAC	2 cut(s)	1152, 1208
TspDTI	ATGAA	8 cut(s)	31, 430, 489, 645, 692, 839, 1439, 1484
TspGWI	ACGGA	1 cut(s)	1450
TspRI	CASTG	3 cut(s)	65, 1152, 1161
VpaK11BI	GGWCC	1 cut(s)	95
VspI	ATTAAT	1 cut(s)	503
XapI	RAATTY	4 cut(s)	164, 319, 1310, 1322
XbaI	TCTAGA	1 cut(s)	964
XceI	RCATGY	2 cut(s)	217, 230
XcmI	CCANNNNNNNNNTGG	1 cut(s)	1057
XhoI	CTCGAG	1 cut(s)	523
XmnI	GAANNNNTTC	1 cut(s)	1299
XspI	CTAG	6 cut(s)	206, 237, 957, 965, 996, 1019
ZraI	GACGTC	1 cut(s)	1152
Zsp2I	ATGCAT	1 cut(s)	219

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.