Rmu_sc0000674.1_g000001

Histone-lysine N-methyltransferase

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000674.1
Physical Location & Seq
Reverse (-)
1 .. 10233
10233 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0000674.1_g000001.1.cds

Sequence Viewer

Length: 6552 bp
atgggcgatggaggagtcgcatgcatgcctttgcagcataatatcatggacaggtttccaattccggagaagactgcgctttgcggaggcaatactaatactaatactaatgctactactactactactaccaccgctaacaatggcttcaattccaagccggttgttaagaagaaggtaatgaagatcaagaagaggattgtcaggaagcccaaggcaaaaagcaacagtaacgtagagtcggggaagagtgagctgggattggttaaaggtgagaagagtgatactactaaggaagcagagaacagtggtggtgccaaggaagcagccgagaagagtggtgtgaaggaagctgtaaaggaagctgagaacagtgctgctcagcaagttgagaacgtcgaaaataatggtgaggataagaaggaggaagtggaagagggtgaattggggactttgaatggtgaatttgttccggacaagtggcggagaagcgaggttgagaaggaggagattgggggtgagaaatggaggagaagcgaggtggagaagggagagtctttttctgggaaatggcgtagaggtgatgcagagaaggcagatatatatcccgagaagagtagaaatagtgaagctgaattcggctcgtggagaccacccaaggatgaaattgaaagaggtgagtatattccagatagatggcaaaaaggagagctggccagagatgactacagtaaccgaaaaatgcccgccaggtacgatatgggtgggaggggcaggggaaggggctggaaatttgagtccccttctggcaagtatccaaatgatgacgggtttagaaggaaagaatatagtagaggtgggggtcagcacagcaagagtactttcaggtgggatagtggccaggagaggaatacgaggatcagttccaaaattgttgatgatgagggtgtctacaagaatgagtacagcagtgagtacagcaatggtaagtatcaagcaaaggattactcttctgttaatcggttgaagaggtatggtcctgattcaaatagtagtgagcggaagcactatggagattatggggattatgcgggtttaaaaagtcgcaagctttctgatgaaagtaatcgctctgctcactctgagcattattcacaccgttctggggagagatcttatcgaaatccttcttttagaccagcatcagacaagtactcttccaggcactatgaacctactttgtcttccagagtggtttatgacaggcatgggcgaagtccaggtctctctgagcggtccccacgtgacaggtcccggtattatgatcacctggaccggagtccagtgcgccgtgagagatctccatatgatctagagaggtccccttatggccgtgagaaatcaccatatggccgtgagagatctccatatggtcatgagaaatctccatatgtacgtgataaatctccacatgttcgtgacagatctccatatgttcgcgacaagtctccatatgctcgcgagaagtcaccatatggacgtgaaagatctccatatgttcgtgacagatctccttatgttctggagagatctccatacgaacggagccgtaattatgatcacagaaaccgcagtttgtctccacaagatcgacctaggtaccatgatcgcagggatcacaccccaaactatttggagcggtcaccacgtggtgaccggggtagagcttctagttatagaggtacaggccgcaaaagtggagcaagtgataggcgcaactcccaatataaagcgcacgaagataagctggtgcagaaggatcccacgggaacggactcaaattcctctgccaaagaatgtcaggatagaagcagtgttcttgacattaatggaactgtggagacaaacaccaattctgagtctcacaaagaagaaccgtctcaaagtccaaatataaattgcaaagaaacttctcatattagtgcagcccctcctgaagagctgccttctatggaagaagatatggatatatgcgacacaccaccacatgtcccagtgattgctgattcatccacagggaaatggttttaccttgattattatggtgtggaatgtgggccttccaaattatgtgagcttaaagcacttgttgaagaaggagctctgatgtccgatcacatggtcaagcactcagacagtgataggtgggtaactgttgaaaatgcagtttcgccattgattaccgtaaattttccatccattgtatcggactcgataactggactagtaagccctccagaagctcctggcaatctattggcagatattggacatactgggcactatggtactcagagtgggagtttaccggggttgtgtgcagatgttgcttctgagcctctagaagatttgcacattgaagaaagggttggggctctgatggaaggtttaacagttattcctggcagggaacttgaagctgttggagaagttctgcaaatgtcatttgaatctgctcaactggaagtatggggaaacagtgaaggtctctctcaaggtcatatcggtgaacagaatgatcagaaaactgaggaaccacgattttctgacattaaaatgaaagaagcagcagaaatagggttgactttaccctctgacaaagatgcttttgcttgtggtgattccggtgactggttttctggtcgatggtcatgcaagggtggtgattggaaaaggaacgaagaaggtgtgcaagataggtcttctagaaagaaacttgttgtcaatgatggtttcccattatgccagatgtcaaaatctgggtatgaagaccctcgatggcaaagaaaagatgaactgtattatccttcacagaacagaaggcttgatctacctacttgggctttttcatgtccagatgatgctaatagagtgtctcaaagtaagccaactgttataaaaggagtaaaaggaactatccttccggtagtcaagataaatgcatgtgttgtaaaagaccacggttcatttgtttctgagccgcgaataaaagcacgaggaatggaaaggcatccttcaaggtctgctcggtcatattccgcaagtagtgatggcaagagatcatctggcgatggtgattctcaaatgaaaccagtaggtgaccgaggctcaaagggatcttccaaatgcgtttcctccattaaaatccccaaagaccgtattggcacagttgatgacttgcaattgcatttgggagactggtactaccttgatggtgctgggcatgaacgaggaccttcatcattctctgagctacaggccttagttgatcaaggagtgatcctgaaacatagcagtgtgttccggaaatttgataaagtctgggttccagttacctctgccattgagacttctgatgctaccaaaatgaataaggagaagaacagaacctcaagtaatttttcagggcaatctcaaagtgctacacttgcagaatcaaaaacaaatttgagttggttgcagaatctgcaccctcagttcattggttatacatgtggaaagcttcatgaattggtgatgaaatcttataaaagtcgggagtttgctgcagccataaatgaggttttagatccatggattaatgcaaggcagccaaaaaaagagttggacaagcacatgtactggaaagcagatggtgatgcacgttcttctaaaagaactcggttgctggttgatgaaagtgaagaagactatgacgcagaagaggacttgcaaacaatagaaaaggatgattccgcatttgaggatctaattggtaatgcttctttcttcagagaagacagcttgagttatggatcagagatggcaagctggggtttattggatggacatgtgctggcacgggtctttcattttttaagattggacatgaaatctcttaccattgcttctctgacttgtaagcactggagagctgcggtcagtttttacaaggatatttcaagacaggtagacttgtcatccttgggtcccaactgcaccgactccatgattgtgaagattatgagtggttatggcaaagagaagattaattctatggttctaattggttgcacaaacatcactccccacactcttgaagagattcttggttcacttccttgtctatctaccatagatattaggggttgcaaccagtttggtgagttggtcattaaatttcagaacctgaactggattaagagccgaagctcacgtggtacaaagatacatgatgaatccaattcaaaattaaggagtctgaaatatatcagtgagaaatcttcttatgtttcgagaagtaaggttctgggtaatgatatggatgattttagtgaactcaaagtgtactttgatagtgtggataagagagactcagctaatcaatcattccggggaagtttatacaaacgttcaaaactatttgatgctagacggtcctcatccattctatctagggatgctcgtatgaggcggttgtccattaagaaatcagaaaatggttataagaggatggaggaatttgttgcttcaagtctgaaggacatcatgaaggagaatacatctgatttctttgtacccaaggttgctgaaattcaagatagaatgagaaatgggtattacattcgccgaggattgagttctgtgaaggaggatatcagtcgaatgtgcagggatgcaattaaagcaaagaatcgtggtgaagctggagatattaatcacctgaatcacattattaatttgtttatacaacttgccacacgtttggaaggggcttccaagtcttctgatgcaagggatgagctgatcaagtcgtgggaagatgatacatttgcaggggtttcttctgcctccaagagtaaaaagaagctcaataagacgtctgaaaggaagttgaggagtaatggttcctttatgaatggtagtgtggataatggagaatatgcatctgatcgagaaatcagaaggcgtttatccaagttgaataaaaaatctatggattcagaaagtgaaacatctgatgatcttgataggtcatctgaagatagcaagagcaatactgagagtactgcctcggatacagaaagtgacttggaatctgggtcacagagtcaacctgggcaatcaacagcagatggatgcttagctcatgatgagggttcagattctgtgactgatgatcgtgagtggggagctcgcatgaccaaatcaagcttggttcctcctgttacgagaaaatatgaagtcattcatgaatatgttattgtatcgcatgaagaggatgtaaagcggaagatgcaggtatctttgccggatgactatgttgagaagctttattcgcagaagaatggaactgaggagtctgatatggaacttcctgaagtcaaggactacaagcccaggaaaatgcttggagatgaggttctagagcaagaggtttatggaattgatccctacagccataatcttttacttgattccatgccagaggagttggattggcctcttttagagaagcatctgtttatagaagatgtgcttcttcgcaccctgaataaggaagttagacactttactggtaccggaactactcccatgatctatcctttgcggcccgttgttgaagatattcggaaaactgctgaagaggatagtgatattcgaactgtgagaatgtgccagggtattttgaaggccatagacagtcgccctgatgataaatatgttgcttatagaaaggggctcggcgttgtttgcaacaaagaagaaggttttggagaagaagattttgttgtggaatttttgggggaggtatatcctgtttggaaatggtatgagaagcaagatgggattcgttctctgcagaaaaacagtaaagatccagctccggaattttacaacatttatcttgaaaggcccaagggtgatgctgatgggtatgatttagttgttgttgatgccatgcataaagcaaactatgcaagtagaatttgtcactcgtgccgacctaattgtgaagcaaaagttactgctgtcgatggtcgttaccagatcggtatctacactgtacgtaaaattcaatatggtgaagagatcacatttgactacaactctgttacggagagtaaggaagaatatgaagcatcagtttgtttgtgtggcagtcaagtttgccggggaagttacctgaatttgacaggcgaaggagcattcctgaaggtgctgaaggattggcatggaattctggatcgtcatcatctaatgctggaagcttgcgagttaaattcagtatctgaggaggattatcttgacctgggaagagctggtttaggcaattgtttgcttggtgggttgccagattgggtgattgcatattcagctcgtttggtgaggttcataaacttcgaaagaacaaagcttcctgaggtgattttaaagcacaacttagaagaaaagaggaagtatttctcagatatatgtcttgaggttgagaagagtgacgcggaggttcag

Protein Analysis

2184

Amino Acids

246.96

Weight (kDa)

6.29

Isoelectric Point (pI)

54.65

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0013012)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 3 cut(s) 2957, 3588, 4545
AatII GACGTC 1 cut(s) 4922
Acc36I ACCTGC 1 cut(s) 5329
Acc65I GGTACC 2 cut(s) 1659, 5618
AccB1I GGYRCC 3 cut(s) 314, 1659, 5618
AccBSI CCGCTC 3 cut(s) 1060, 1294, 1699
AccI GTMKAC 2 cut(s) 951, 4011
AccII CGCG 4 cut(s) 1500, 1521, 3043, 6542
AccIII TCCGGA 4 cut(s) 64, 472, 3363, 5926
AclI AACGTT 1 cut(s) 4450
AcoI YGGCCR 4 cut(s) 714, 898, 1390, 1411
AcuI CTGAAG 8 cut(s) 2016, 3814, 4598, 5100, 5439, 5703, 6275, 6284
AcvI CACGTG 3 cut(s) 1304, 1709, 4256
AcyI GRCGYC 1 cut(s) 4919
AdeI CACNNNGTG 2 cut(s) 1709, 1712
AfiI CCNNNNNNNGG 3 cut(s) 1165, 2691, 5596
AflIII ACRYGT 6 cut(s) 1471, 2047, 3551, 3675, 3889, 4799
AhlI ACTAGT 1 cut(s) 2284
AjiI CACGTC 1 cut(s) 1541
AjuI GAANNNNNNNTTGG 6 cut(s) 2412, 2444, 4131, 4163, 5796, 5828
AloI GAACNNNNNNTCC 8 cut(s) 2965, 2997, 4930, 4962, 5445, 5477, 6442, 6474
Alw21I GWGCWC 2 cut(s) 2164, 5236
AlwNI CAGNNNCTG 4 cut(s) 3526, 4228, 5207, 6332
Ama87I CYCGRG 1 cut(s) 608
Aor13HI TCCGGA 4 cut(s) 64, 472, 3363, 5926
ArsI GACNNNNNNTTYG 2 cut(s) 1267, 1299
AseI ATTAAT 5 cut(s) 1887, 3639, 4089, 4755, 4776
Asp700I GAANNNNTTC 6 cut(s) 468, 1186, 4143, 5286, 5667, 6503
Asp718I GGTACC 2 cut(s) 1659, 5618
AspA2I CCTAGG 1 cut(s) 1655
AspLEI GCGC 4 cut(s) 79, 1350, 1776, 1795
AsuC2I CCSGG 5 cut(s) 1315, 1718, 2370, 4433, 6215
AsuII TTCGAA 2 cut(s) 5701, 6444
AvaI CYCGRG 1 cut(s) 608
AvaII GGWCC 8 cut(s) 1037, 1296, 1311, 1333, 1380, 3293, 4028, 4476
AvrII CCTAGG 1 cut(s) 1655
AxyI CCTNAGG 1 cut(s) 6462
BaeGI GKGCMC 1 cut(s) 2343
BaeI ACNNNNGTAYC 2 cut(s) 1643, 1676
BalI TGGCCA 2 cut(s) 716, 900
BamHI GGATCC 1 cut(s) 1819
BanI GGYRCC 3 cut(s) 314, 1659, 5618
BanII GRGCYC 4 cut(s) 2164, 2437, 5236, 5784
BauI CACGAG 3 cut(s) 643, 3054, 6037
BbrPI CACGTG 3 cut(s) 1304, 1709, 4256
BbsI GAAGAC 7 cut(s) 77, 1236, 2754, 2835, 3753, 3843, 4815
Bbv12I GWGCWC 2 cut(s) 2164, 5236
BceAI ACGGC 4 cut(s) 1335, 1377, 1398, 1593
BcgI CGANNNNNNTGC 2 cut(s) 2694, 2728
BciVI GTATCC 2 cut(s) 825, 5110
BclI TGATCA 5 cut(s) 1324, 1618, 2578, 3328, 4845
BcnI CCSGG 5 cut(s) 1315, 1718, 2370, 4433, 6215
BcuI ACTAGT 1 cut(s) 2284
BfaI CTAG 9 cut(s) 1373, 1656, 1731, 2285, 2402, 2766, 4470, 4494, 5465
BfmI CTRYAG 5 cut(s) 727, 3314, 3606, 5494, 5900
BfuAI ACCTGC 1 cut(s) 5329
BfuI GTATCC 2 cut(s) 825, 5110
BglII AGATCT 7 cut(s) 1172, 1358, 1421, 1484, 1547, 1568, 1589
BlnI CCTAGG 1 cut(s) 1655
BlpI GCTNAGC 2 cut(s) 381, 5182
BmcAI AGTACT 3 cut(s) 880, 1214, 5107
Bme18I GGWCC 8 cut(s) 1037, 1296, 1311, 1333, 1380, 3293, 4028, 4476
BmeT110I CYCGRG 1 cut(s) 608
BmgBI CACGTC 1 cut(s) 1541
BmrI ACTGGG 2 cut(s) 2048, 2346
BmuI ACTGGG 2 cut(s) 2048, 2346
BoxI GACNNNNGTC 1 cut(s) 1338
BpiI GAAGAC 7 cut(s) 77, 1236, 2754, 2835, 3753, 3843, 4815
BpmI CTGGAG 4 cut(s) 1604, 2280, 3988, 4767
Bpu1102I GCTNAGC 2 cut(s) 381, 5182
Bpu14I TTCGAA 2 cut(s) 5701, 6444
BpuEI CTTGAG 4 cut(s) 2538, 3436, 3865, 6542
BpuMI CCSGG 5 cut(s) 1315, 1718, 2370, 4433, 6215
BsaAI YACGTR 5 cut(s) 1304, 1457, 1709, 4256, 6110
BsaBI GATNNNNATC 4 cut(s) 603, 4755, 6095, 6291
BsaHI GRCGYC 1 cut(s) 4919
BsaI GGTCTC 3 cut(s) 643, 1289, 2552
BsaWI WCCGGW 8 cut(s) 64, 472, 1335, 2684, 2983, 3363, 5621, 5926
BsaXI ACNNNNNCTCC 4 cut(s) 4930, 4960, 5445, 5475
Bsc4I CCNNNNNNNGG 3 cut(s) 1165, 2691, 5596
Bse118I RCCGGY 1 cut(s) 160
Bse21I CCTNAGG 1 cut(s) 6462
Bse3DI GCAATG 2 cut(s) 988, 3942
Bse8I GATNNNNATC 4 cut(s) 603, 4755, 6095, 6291
BseAI TCCGGA 4 cut(s) 64, 472, 3363, 5926
BseJI GATNNNNATC 4 cut(s) 603, 4755, 6095, 6291
BseLI CCNNNNNNNGG 3 cut(s) 1165, 2691, 5596
BseMI GCAATG 2 cut(s) 988, 3942
BseRI GAGGAG 7 cut(s) 27, 521, 544, 4951, 5411, 5543, 6350
BseSI GKGCMC 1 cut(s) 2343
BseYI CCCAGC 3 cut(s) 256, 3278, 3870
BsgI GTGCAG 6 cut(s) 1832, 2004, 2400, 3512, 4021, 4729
Bsh1236I CGCG 4 cut(s) 1500, 1521, 3043, 6542
BshNI GGYRCC 3 cut(s) 314, 1659, 5618
BsiHKAI GWGCWC 2 cut(s) 2164, 5236
BsiHKCI CYCGRG 1 cut(s) 608
BslFI GGGAC 7 cut(s) 463, 784, 1282, 1297, 1366, 2036, 4014
BslI CCNNNNNNNGG 3 cut(s) 1165, 2691, 5596
BsmBI CGTCTC 1 cut(s) 1944
BsmFI GGGAC 7 cut(s) 463, 784, 1282, 1297, 1366, 2036, 4014
BsmI GAATGC 1 cut(s) 6248
Bso31I GGTCTC 3 cut(s) 643, 1289, 2552
BsoBI CYCGRG 1 cut(s) 608
Bsp119I TTCGAA 2 cut(s) 5701, 6444
Bsp1286I GDGCHC 5 cut(s) 2164, 2343, 2437, 5236, 5784
Bsp13I TCCGGA 4 cut(s) 64, 472, 3363, 5926
Bsp1720I GCTNAGC 2 cut(s) 381, 5182
Bsp19I CCATGG 1 cut(s) 3632
Bsp68I TCGCGA 2 cut(s) 1500, 1521
BspEI TCCGGA 4 cut(s) 64, 472, 3363, 5926
BspFNI CGCG 4 cut(s) 1500, 1521, 3043, 6542
BspHI TCATGA 5 cut(s) 1435, 3565, 4587, 5188, 5290
BspMAI CTGCAG 2 cut(s) 3610, 5904
BspMI ACCTGC 1 cut(s) 5329
BspQI GCTCTTC 2 cut(s) 1992, 6352
BspT104I TTCGAA 2 cut(s) 5701, 6444
BspT107I GGYRCC 3 cut(s) 314, 1659, 5618
BspTNI GGTCTC 3 cut(s) 643, 1289, 2552
BsrBI CCGCTC 3 cut(s) 1060, 1294, 1699
BsrDI GCAATG 2 cut(s) 988, 3942
BsrFI RCCGGY 1 cut(s) 160
BssAI RCCGGY 1 cut(s) 160
BssNI GRCGYC 1 cut(s) 4919
BssSI CACGAG 3 cut(s) 643, 3054, 6037
BssT1I CCWWGG 8 cut(s) 213, 318, 657, 1655, 3632, 4023, 4620, 5958
Bst2BI CACGAG 3 cut(s) 643, 3054, 6037
BstACI GRCGYC 1 cut(s) 4919
BstAPI GCANNNNNTGC 3 cut(s) 2387, 3526, 6017
BstBAI YACGTR 5 cut(s) 1304, 1457, 1709, 4256, 6110
BstBI TTCGAA 2 cut(s) 5701, 6444
BstDSI CCRYGG 3 cut(s) 1824, 3019, 3632
BstEII GGTNACC 3 cut(s) 1701, 1712, 3158
BstENI CCTNNNNNAGG 1 cut(s) 5594
BstFNI CGCG 4 cut(s) 1500, 1521, 3043, 6542
BstHHI GCGC 4 cut(s) 79, 1350, 1776, 1795
BstNSI RCATGY 8 cut(s) 24, 28, 1475, 2051, 3006, 3555, 3679, 3893
BstPAI GACNNNNGTC 1 cut(s) 1338
BstPI GGTNACC 3 cut(s) 1701, 1712, 3158
BstSFI CTRYAG 5 cut(s) 727, 3314, 3606, 5494, 5900
BstSLI GKGCMC 1 cut(s) 2343
BstSNI TACGTA 1 cut(s) 6110
BstUI CGCG 4 cut(s) 1500, 1521, 3043, 6542
BstV2I GAAGAC 7 cut(s) 77, 1236, 2754, 2835, 3753, 3843, 4815
BstXI CCANNNNNNTGG 2 cut(s) 696, 4804
Bsu36I CCTNAGG 1 cut(s) 6462
BsuI GTATCC 2 cut(s) 825, 5110
BtgI CCRYGG 3 cut(s) 1824, 3019, 3632
BtgZI GCGATG 2 cut(s) 21, 3144
BtrI CACGTC 1 cut(s) 1541
BtsI GCAGTG 3 cut(s) 976, 1879, 3361
BtuMI TCGCGA 2 cut(s) 1500, 1521
BveI ACCTGC 1 cut(s) 5329
CaiI CAGNNNCTG 4 cut(s) 3526, 4228, 5207, 6332
CciI TCATGA 5 cut(s) 1435, 3565, 4587, 5188, 5290
CfoI GCGC 4 cut(s) 79, 1350, 1776, 1795
Cfr10I RCCGGY 1 cut(s) 160
CseI GACGC 1 cut(s) 3764
DraI TTTAAA 2 cut(s) 1098, 6474
DraIII CACNNNGTG 2 cut(s) 1709, 1712
EaeI YGGCCR 4 cut(s) 714, 898, 1390, 1411
EciI GGCGGA 1 cut(s) 499
Ecl136II GAGCTC 2 cut(s) 2162, 5234
Eco105I TACGTA 1 cut(s) 6110
Eco130I CCWWGG 8 cut(s) 213, 318, 657, 1655, 3632, 4023, 4620, 5958
Eco147I AGGCCT 1 cut(s) 3320
Eco24I GRGCYC 4 cut(s) 2164, 2437, 5236, 5784
Eco31I GGTCTC 3 cut(s) 643, 1289, 2552
Eco32I GATATC 1 cut(s) 4696
Eco47I GGWCC 8 cut(s) 1037, 1296, 1311, 1333, 1380, 3293, 4028, 4476
Eco53kI GAGCTC 2 cut(s) 2162, 5234
Eco57I CTGAAG 8 cut(s) 2016, 3814, 4598, 5100, 5439, 5703, 6275, 6284
Eco72I CACGTG 3 cut(s) 1304, 1709, 4256
Eco81I CCTNAGG 1 cut(s) 6462
Eco88I CYCGRG 1 cut(s) 608
Eco91I GGTNACC 3 cut(s) 1701, 1712, 3158
EcoICRI GAGCTC 2 cut(s) 2162, 5234
EcoNI CCTNNNNNAGG 1 cut(s) 5594
EcoO109I RGGNCCY 4 cut(s) 1311, 1380, 3293, 4028
EcoO65I GGTNACC 3 cut(s) 1701, 1712, 3158
EcoRI GAATTC 2 cut(s) 635, 6279
EcoRV GATATC 1 cut(s) 4696
EcoT14I CCWWGG 8 cut(s) 213, 318, 657, 1655, 3632, 4023, 4620, 5958
EcoT22I ATGCAT 4 cut(s) 26, 3004, 4987, 6006
EcoT38I GRGCYC 4 cut(s) 2164, 2437, 5236, 5784
ErhI CCWWGG 8 cut(s) 213, 318, 657, 1655, 3632, 4023, 4620, 5958
Esp3I CGTCTC 1 cut(s) 1944
FalI AAGNNNNNCTT 8 cut(s) 3058, 3090, 4131, 4163, 5562, 5594, 6467, 6499
FaqI GGGAC 7 cut(s) 463, 784, 1282, 1297, 1366, 2036, 4014
FauI CCCGC 2 cut(s) 754, 1084
FauNDI CATATG 8 cut(s) 1366, 1408, 1429, 1450, 1492, 1513, 1534, 1555
FbaI TGATCA 5 cut(s) 1324, 1618, 2578, 3328, 4845
FblI GTMKAC 2 cut(s) 951, 4011
FriOI GRGCYC 4 cut(s) 2164, 2437, 5236, 5784
FspBI CTAG 9 cut(s) 1373, 1656, 1731, 2285, 2402, 2766, 4470, 4494, 5465
GlaI GCGC 4 cut(s) 78, 1349, 1775, 1794
GsaI CCCAGC 3 cut(s) 260, 3282, 3874
GsuI CTGGAG 4 cut(s) 1604, 2280, 3988, 4767
HgaI GACGC 1 cut(s) 3764
HhaI GCGC 4 cut(s) 79, 1350, 1776, 1795
Hin1I GRCGYC 1 cut(s) 4919
Hin6I GCGC 4 cut(s) 77, 1348, 1774, 1793
HinP1I GCGC 4 cut(s) 77, 1348, 1774, 1793
HincII GTYRAC 2 cut(s) 2643, 5153
HindII GTYRAC 2 cut(s) 2643, 5153
HindIII AAGCTT 6 cut(s) 1109, 3560, 5251, 5369, 6309, 6455
Hpy166II GTNNAC 9 cut(s) 952, 2366, 2570, 2643, 4012, 4154, 4376, 4387, 5153
Hpy8I GTNNAC 9 cut(s) 952, 2366, 2570, 2643, 4012, 4154, 4376, 4387, 5153
Hpy99I CGWCG 1 cut(s) 401
Hsp92I GRCGYC 1 cut(s) 4919
HspAI GCGC 4 cut(s) 77, 1348, 1774, 1793
KflI GGGWCCC 1 cut(s) 4028
Kpn2I TCCGGA 4 cut(s) 64, 472, 3363, 5926
KpnI GGTACC 2 cut(s) 1663, 5622
Ksp22I TGATCA 5 cut(s) 1324, 1618, 2578, 3328, 4845
LguI GCTCTTC 2 cut(s) 1992, 6352
LmnI GCTCC 8 cut(s) 1605, 1696, 1760, 2159, 2308, 5231, 5929, 6245
MaeI CTAG 9 cut(s) 1373, 1656, 1731, 2285, 2402, 2766, 4470, 4494, 5465
MbiI CCGCTC 3 cut(s) 1060, 1294, 1699
MfeI CAATTG 2 cut(s) 3242, 6373
MhlI GDGCHC 5 cut(s) 2164, 2343, 2437, 5236, 5784
MlsI TGGCCA 2 cut(s) 716, 900
MluNI TGGCCA 2 cut(s) 716, 900
MmeI TCCRAC 3 cut(s) 2464, 3645, 5514
Mox20I TGGCCA 2 cut(s) 716, 900
Mph1103I ATGCAT 4 cut(s) 26, 3004, 4987, 6006
MroI TCCGGA 4 cut(s) 64, 472, 3363, 5926
MroXI GAANNNNTTC 6 cut(s) 468, 1186, 4143, 5286, 5667, 6503
MscI TGGCCA 2 cut(s) 716, 900
MslI CAYNNNNRTG 7 cut(s) 1476, 1980, 2565, 2615, 3354, 4052, 5295
Msp20I TGGCCA 2 cut(s) 716, 900
MunI CAATTG 2 cut(s) 3242, 6373
Mva1269I GAATGC 1 cut(s) 6248
MvnI CGCG 4 cut(s) 1500, 1521, 3043, 6542
NciI CCSGG 5 cut(s) 1315, 1718, 2370, 4433, 6215
NcoI CCATGG 1 cut(s) 3632
NdeI CATATG 8 cut(s) 1366, 1408, 1429, 1450, 1492, 1513, 1534, 1555
NmeAIII GCCGAG 3 cut(s) 355, 4694, 5763
NruI TCGCGA 2 cut(s) 1500, 1521
NsiI ATGCAT 4 cut(s) 26, 3004, 4987, 6006
NspI RCATGY 8 cut(s) 24, 28, 1475, 2051, 3006, 3555, 3679, 3893
NspV TTCGAA 2 cut(s) 5701, 6444
PaeI GCATGC 2 cut(s) 24, 28
PagI TCATGA 5 cut(s) 1435, 3565, 4587, 5188, 5290
PceI AGGCCT 1 cut(s) 3320
PciI ACATGT 5 cut(s) 1471, 2047, 3551, 3675, 3889
PciSI GCTCTTC 2 cut(s) 1992, 6352
PctI GAATGC 1 cut(s) 6248
PdmI GAANNNNTTC 6 cut(s) 468, 1186, 4143, 5286, 5667, 6503
PmaCI CACGTG 3 cut(s) 1304, 1709, 4256
PmlI CACGTG 3 cut(s) 1304, 1709, 4256
Ppu21I YACGTR 5 cut(s) 1304, 1457, 1709, 4256, 6110
PpuMI RGGWCCY 4 cut(s) 1311, 1380, 3293, 4028
PscI ACATGT 5 cut(s) 1471, 2047, 3551, 3675, 3889
PshAI GACNNNNGTC 1 cut(s) 1338
PshBI ATTAAT 5 cut(s) 1887, 3639, 4089, 4755, 4776
PsiI TTATAA 3 cut(s) 2957, 3588, 4545
Psp124BI GAGCTC 2 cut(s) 2164, 5236
Psp1406I AACGTT 1 cut(s) 4450
Psp5II RGGWCCY 4 cut(s) 1311, 1380, 3293, 4028
PspCI CACGTG 3 cut(s) 1304, 1709, 4256
PspEI GGTNACC 3 cut(s) 1701, 1712, 3158
PspFI CCCAGC 3 cut(s) 256, 3278, 3870
PspPPI RGGWCCY 4 cut(s) 1311, 1380, 3293, 4028
PstI CTGCAG 2 cut(s) 3610, 5904
PstNI CAGNNNCTG 4 cut(s) 3526, 4228, 5207, 6332
RruI TCGCGA 2 cut(s) 1500, 1521
RseI CAYNNNNRTG 7 cut(s) 1476, 1980, 2565, 2615, 3354, 4052, 5295
SacI GAGCTC 2 cut(s) 2164, 5236
SapI GCTCTTC 2 cut(s) 1992, 6352
ScaI AGTACT 3 cut(s) 880, 1214, 5107
SduI GDGCHC 5 cut(s) 2164, 2343, 2437, 5236, 5784
SfcI CTRYAG 5 cut(s) 727, 3314, 3606, 5494, 5900
SfuI TTCGAA 2 cut(s) 5701, 6444
SinI GGWCC 8 cut(s) 1037, 1296, 1311, 1333, 1380, 3293, 4028, 4476
SmiMI CAYNNNNRTG 7 cut(s) 1476, 1980, 2565, 2615, 3354, 4052, 5295
SmlI CTYRAG 4 cut(s) 2553, 3451, 3844, 6521
SmoI CTYRAG 4 cut(s) 2553, 3451, 3844, 6521
SnaBI TACGTA 1 cut(s) 6110
SpeI ACTAGT 1 cut(s) 2284
SphI GCATGC 2 cut(s) 24, 28
SseBI AGGCCT 1 cut(s) 3320
SspMI CTAG 9 cut(s) 1373, 1656, 1731, 2285, 2402, 2766, 4470, 4494, 5465
SstI GAGCTC 2 cut(s) 2164, 5236
StuI AGGCCT 1 cut(s) 3320
StyI CCWWGG 8 cut(s) 213, 318, 657, 1655, 3632, 4023, 4620, 5958
TaqII GACCGA 2 cut(s) 3078, 3177
TatI WGTACW 7 cut(s) 878, 963, 975, 1212, 3678, 4386, 5105
TauI GCSGC 3 cut(s) 1752, 3043, 5653
TspGWI ACGGA 3 cut(s) 1618, 1847, 6173
VpaK11BI GGWCC 8 cut(s) 1037, 1296, 1311, 1333, 1380, 3293, 4028, 4476
VspI ATTAAT 5 cut(s) 1887, 3639, 4089, 4755, 4776
XagI CCTNNNNNAGG 1 cut(s) 5594
XbaI TCTAGA 4 cut(s) 1372, 2401, 2765, 5464
XceI RCATGY 8 cut(s) 24, 28, 1475, 2051, 3006, 3555, 3679, 3893
XcmI CCANNNNNNNNNTGG 2 cut(s) 757, 5251
XmaJI CCTAGG 1 cut(s) 1655
XmiI GTMKAC 2 cut(s) 951, 4011
XmnI GAANNNNTTC 6 cut(s) 468, 1186, 4143, 5286, 5667, 6503
XspI CTAG 9 cut(s) 1373, 1656, 1731, 2285, 2402, 2766, 4470, 4494, 5465
ZraI GACGTC 1 cut(s) 4920
ZrmI AGTACT 3 cut(s) 880, 1214, 5107
Zsp2I ATGCAT 4 cut(s) 26, 3004, 4987, 6006
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.