Rmu_sc0000795.1_g000089

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000795.1
OG0015762
Physical Location & Seq
Forward (+)
394400 .. 394672
273 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0000795.1_g000089.1.cds

Sequence Viewer

Length: 273 bp
atgcagcaaaaaatactcttatcaagtgcagggaagaaaacggtggagtacacagtgccattagcagagaagactaaagacatggccatgtttgcaggtaagaccactctgcattatgttggtcatgttgcggtggatttgaaggtcaaggccactgtggtaggttggactgcagcgcactacgcaactgaggcagcagtggagggaaccaaagcagctgcaaggttggagctcaaatgcacagcaaggagggcaggaatggagctcaaatga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

90

Amino Acids

9.69

Weight (kDa)

9.63

Isoelectric Point (pI)

29.9

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 86
AciI CCGC 1 cut(s) 131
AcoI YGGCCR 1 cut(s) 84
AfaI GTAC 1 cut(s) 50
AgsI TTSAA 1 cut(s) 142
AluBI AGCT 3 cut(s) 218, 232, 265
AluI AGCT 3 cut(s) 218, 232, 265
Alw21I GWGCWC 2 cut(s) 234, 267
AoxI GGCC 2 cut(s) 84, 150
ApeKI GCWGC 5 cut(s) 4, 173, 194, 215, 218
AspLEI GCGC 1 cut(s) 178
BalI TGGCCA 1 cut(s) 86
BanII GRGCYC 2 cut(s) 234, 267
BbsI GAAGAC 1 cut(s) 77
Bbv12I GWGCWC 2 cut(s) 234, 267
BbvI GCAGC 5 cut(s) 16, 185, 205, 206, 227
BfmI CTRYAG 1 cut(s) 171
BfuAI ACCTGC 1 cut(s) 86
BisI GCNGC 5 cut(s) 5, 174, 195, 216, 219
BlsI GCNGC 5 cut(s) 6, 175, 196, 217, 220
BmiI GGNNCC 1 cut(s) 208
BpiI GAAGAC 1 cut(s) 77
BseMII CTCAG 1 cut(s) 180
BseXI GCAGC 5 cut(s) 16, 185, 205, 206, 227
BsgI GTGCAG 1 cut(s) 48
BshFI GGCC 2 cut(s) 86, 152
BsiHKAI GWGCWC 2 cut(s) 234, 267
BsnI GGCC 2 cut(s) 86, 152
Bsp1286I GDGCHC 2 cut(s) 234, 267
BspACI CCGC 1 cut(s) 131
BspANI GGCC 2 cut(s) 86, 152
BspCNI CTCAG 1 cut(s) 181
BspLI GGNNCC 1 cut(s) 208
BspMAI CTGCAG 1 cut(s) 175
BspMI ACCTGC 1 cut(s) 86
Bst4CI ACNGT 3 cut(s) 43, 55, 157
BstDEI CTNAG 1 cut(s) 189
BstHHI GCGC 1 cut(s) 178
BstMWI GCNNNNNNNGC 4 cut(s) 92, 182, 191, 251
BstSFI CTRYAG 1 cut(s) 171
BstV1I GCAGC 5 cut(s) 16, 185, 205, 206, 227
BstV2I GAAGAC 1 cut(s) 77
BsuRI GGCC 2 cut(s) 86, 152
BtsI GCAGTG 1 cut(s) 204
BtsIMutI CAGTG 3 cut(s) 60, 153, 204
BveI ACCTGC 1 cut(s) 86
CfoI GCGC 1 cut(s) 178
Csp6I GTAC 1 cut(s) 49
CviAII CATG 3 cut(s) 82, 88, 125
CviJI RGCY 5 cut(s) 86, 152, 218, 232, 265
CviKI_1 RGCY 5 cut(s) 86, 152, 218, 232, 265
CviQI GTAC 1 cut(s) 49
DdeI CTNAG 1 cut(s) 189
EaeI YGGCCR 1 cut(s) 84
Ecl136II GAGCTC 2 cut(s) 232, 265
Eco24I GRGCYC 2 cut(s) 234, 267
Eco53kI GAGCTC 2 cut(s) 232, 265
EcoICRI GAGCTC 2 cut(s) 232, 265
EcoT38I GRGCYC 2 cut(s) 234, 267
FaeI CATG 3 cut(s) 85, 91, 128
FaiI YATR 4 cut(s) 83, 89, 117, 126
FatI CATG 3 cut(s) 81, 87, 124
Fnu4HI GCNGC 5 cut(s) 5, 174, 195, 216, 219
FriOI GRGCYC 2 cut(s) 234, 267
Fsp4HI GCNGC 5 cut(s) 5, 174, 195, 216, 219
GlaI GCGC 1 cut(s) 177
GluI GCNGC 5 cut(s) 5, 174, 195, 216, 219
HaeIII GGCC 2 cut(s) 86, 152
HhaI GCGC 1 cut(s) 178
Hin1II CATG 3 cut(s) 85, 91, 128
Hin6I GCGC 1 cut(s) 176
HinP1I GCGC 1 cut(s) 176
Hpy166II GTNNAC 1 cut(s) 51
Hpy8I GTNNAC 1 cut(s) 51
HpyAV CCTTC 1 cut(s) 136
HpyCH4III ACNGT 3 cut(s) 43, 55, 157
HpyCH4V TGCA 7 cut(s) 4, 29, 95, 112, 173, 221, 240
HpyF10VI GCNNNNNNNGC 4 cut(s) 92, 182, 191, 251
HpyF3I CTNAG 1 cut(s) 189
Hsp92II CATG 3 cut(s) 85, 91, 128
HspAI GCGC 1 cut(s) 176
LmnI GCTCC 2 cut(s) 229, 262
LpnPI CCDG 3 cut(s) 15, 81, 240
Lsp1109I GCAGC 5 cut(s) 16, 185, 205, 206, 227
MboII GAAGA 2 cut(s) 46, 82
MhlI GDGCHC 2 cut(s) 234, 267
MlsI TGGCCA 1 cut(s) 86
MluNI TGGCCA 1 cut(s) 86
MmeI TCCRAC 2 cut(s) 146, 207
MnlI CCTC 3 cut(s) 184, 196, 243
Mox20I TGGCCA 1 cut(s) 86
MscI TGGCCA 1 cut(s) 86
MslI CAYNNNNRTG 1 cut(s) 86
Msp20I TGGCCA 1 cut(s) 86
MspA1I CMGCKG 1 cut(s) 218
MwoI GCNNNNNNNGC 4 cut(s) 92, 182, 191, 251
NlaIII CATG 3 cut(s) 85, 91, 128
NlaIV GGNNCC 1 cut(s) 208
PkrI GCNGC 5 cut(s) 6, 175, 196, 217, 220
Psp124BI GAGCTC 2 cut(s) 234, 267
PspN4I GGNNCC 1 cut(s) 208
PstI CTGCAG 1 cut(s) 175
PvuII CAGCTG 1 cut(s) 218
RsaI GTAC 1 cut(s) 50
RsaNI GTAC 1 cut(s) 49
RseI CAYNNNNRTG 1 cut(s) 86
SacI GAGCTC 2 cut(s) 234, 267
SatI GCNGC 5 cut(s) 5, 174, 195, 216, 219
SduI GDGCHC 2 cut(s) 234, 267
SetI ASST 7 cut(s) 100, 147, 166, 220, 227, 234, 267
SfcI CTRYAG 1 cut(s) 171
SmiMI CAYNNNNRTG 1 cut(s) 86
SsiI CCGC 1 cut(s) 131
SstI GAGCTC 2 cut(s) 234, 267
TaaI ACNGT 3 cut(s) 43, 55, 157
TatI WGTACW 1 cut(s) 48
TscAI CASTG 3 cut(s) 60, 160, 204
TseI GCWGC 5 cut(s) 4, 173, 194, 215, 218
TspRI CASTG 3 cut(s) 60, 160, 204
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.