Rmu_sc0001190.1_g000001

Belongs to the RecA family

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0001190.1
Physical Location & Seq
Reverse (-)
4120 .. 4604
485 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0001190.1_g000001.1.cds

Sequence Viewer

Length: 300 bp
ctggattatgatgataatggcgatgctaaagcaagagagaaagatgttgcactgcatttgcctctcccacggctttctggcgatttcgagcacgaatctatgttgtccttgccgtggttttttcactcaaggcgtgcacctgttatctccactggttccttgaagcttgatatagctttcgggactggaggattaccaaagggaagaattgttgagatttatgggcaggaagcatttggcaggactacgctcgcccttcacatcatcaaggaagcccaaaagcttggaggtgtgtattaa

Protein Analysis

99

Amino Acids

10.92

Weight (kDa)

6.46

Isoelectric Point (pI)

31.03

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfiI CCNNNNNNNGG 1 cut(s) 114
AgsI TTSAA 1 cut(s) 163
AluBI AGCT 3 cut(s) 166, 176, 283
AluI AGCT 3 cut(s) 166, 176, 283
Alw21I GWGCWC 2 cut(s) 93, 139
Alw44I GTGCAC 1 cut(s) 135
ApaLI GTGCAC 1 cut(s) 135
BaeGI GKGCMC 1 cut(s) 139
Bbv12I GWGCWC 2 cut(s) 93, 139
BceAI ACGGC 2 cut(s) 86, 97
BmiI GGNNCC 1 cut(s) 157
BmsI GCATC 1 cut(s) 13
BpmI CTGGAG 1 cut(s) 207
BpuEI CTTGAG 1 cut(s) 112
BsaJI CCNNGG 2 cut(s) 68, 113
Bsc4I CCNNNNNNNGG 1 cut(s) 114
Bse1I ACTGG 2 cut(s) 157, 190
BseDI CCNNGG 2 cut(s) 68, 113
BseLI CCNNNNNNNGG 1 cut(s) 114
BseNI ACTGG 2 cut(s) 157, 190
BseSI GKGCMC 1 cut(s) 139
BsiHKAI GWGCWC 2 cut(s) 93, 139
BslFI GGGAC 1 cut(s) 196
BslI CCNNNNNNNGG 1 cut(s) 114
BsmFI GGGAC 1 cut(s) 196
Bsp1286I GDGCHC 2 cut(s) 93, 139
BspLI GGNNCC 1 cut(s) 157
BsrI ACTGG 2 cut(s) 157, 190
BssECI CCNNGG 2 cut(s) 68, 113
BstC8I GCNNGC 2 cut(s) 135, 252
BstDSI CCRYGG 2 cut(s) 68, 113
BstSLI GKGCMC 1 cut(s) 139
BstXI CCANNNNNNTGG 1 cut(s) 284
BtgI CCRYGG 2 cut(s) 68, 113
BtgZI GCGATG 1 cut(s) 36
BtsI GCAGTG 1 cut(s) 50
BtsIMutI CAGTG 2 cut(s) 50, 150
Cac8I GCNNGC 2 cut(s) 135, 252
CviJI RGCY 5 cut(s) 73, 166, 176, 275, 283
CviKI_1 RGCY 5 cut(s) 73, 166, 176, 275, 283
FaiI YATR 4 cut(s) 9, 101, 173, 222
FaqI GGGAC 1 cut(s) 196
GsuI CTGGAG 1 cut(s) 207
HindIII AAGCTT 2 cut(s) 164, 281
HinfI GANTC 1 cut(s) 95
Hpy166II GTNNAC 1 cut(s) 137
Hpy188III TCNNGA 1 cut(s) 181
Hpy8I GTNNAC 1 cut(s) 137
HpyAV CCTTC 1 cut(s) 266
HpyCH4V TGCA 3 cut(s) 50, 55, 137
LpnPI CCDG 6 cut(s) 63, 138, 153, 171, 212, 226
LweI GCATC 1 cut(s) 13
MboII GAAGA 1 cut(s) 216
MhlI GDGCHC 2 cut(s) 93, 139
MluCI AATT 1 cut(s) 207
MnlI CCTC 3 cut(s) 72, 182, 281
MseI TTAA 1 cut(s) 298
NlaIV GGNNCC 1 cut(s) 157
PfeI GAWTC 1 cut(s) 95
PspN4I GGNNCC 1 cut(s) 157
SaqAI TTAA 1 cut(s) 298
SduI GDGCHC 2 cut(s) 93, 139
SetI ASST 5 cut(s) 142, 168, 178, 285, 292
SfaNI GCATC 1 cut(s) 13
SmlI CTYRAG 1 cut(s) 127
SmoI CTYRAG 1 cut(s) 127
Sse9I AATT 1 cut(s) 207
TaqI TCGA 1 cut(s) 87
TasI AATT 1 cut(s) 207
TfiI GAWTC 1 cut(s) 95
Tru1I TTAA 1 cut(s) 298
Tru9I TTAA 1 cut(s) 298
TscAI CASTG 2 cut(s) 57, 157
TspRI CASTG 2 cut(s) 57, 157
VneI GTGCAC 1 cut(s) 135
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.