Rmu_sc0001353.1_g000028

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0001353.1
OG0015773
Physical Location & Seq
Forward (+)
80267 .. 83912
3646 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0001353.1_g000028.1.cds

Sequence Viewer

Length: 714 bp
atgggcttgcttgtggcggcgccaagtttatgggcctgggtagatggcttctcagctctatccggtcaccttaggaaggatggaggcggagttcatcttcatcaacgtgcttctgaacttgtcgaactctggtttcgacttctgttcctggttatgttgatctaccgatctgctatggctatgggctcatatccagtggtggtggctactggtggttttggtttttgggatgccgactggaccctctctggggtttttgaggcggattcgctacaatgggctggcttagggcgtcttccgtggggtgaagccggaggttgtgctcgtaacggtggcatggtggtcggcagcgcagaggactgcagggatgctagggattctcaggtttcctactcggtagatggtttagagtatttgggccaattgggcctcaaactggatggtgagcctcatccttgggcttggtctagggttatgcaaggcttggactacctctttgctagggggttggatggttgggtctctatggcccaaagagacagaattttggtgaggtggatcttggtgaggagacagaattttaatgaggaggatcttgatgaggagaaggaaaaaatggagaaggaatggaaagagagctgcccgaagcgctgcctctgttttggtggtgcggcactgctggttctcaagaggaagaggaataattggaattaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

237

Amino Acids

26.64

Weight (kDa)

5.86

Isoelectric Point (pI)

38.67

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 19
AciI CCGC 4 cut(s) 17, 87, 263, 671
AclWI GGATC 2 cut(s) 566, 600
AcsI RAATTY 2 cut(s) 543, 577
AcyI GRCGYC 2 cut(s) 20, 292
AfeI AGCGCT 1 cut(s) 650
AfiI CCNNNNNNNGG 4 cut(s) 76, 249, 250, 436
AjnI CCWGG 2 cut(s) 35, 147
AloI GAACNNNNNNTCC 2 cut(s) 75, 107
AluBI AGCT 2 cut(s) 56, 639
AluI AGCT 2 cut(s) 56, 639
Alw21I GWGCWC 1 cut(s) 325
Alw26I GTCTC 3 cut(s) 526, 531, 565
AlwI GGATC 2 cut(s) 566, 600
Aor51HI AGCGCT 1 cut(s) 650
AoxI GGCC 4 cut(s) 33, 418, 427, 528
ApeKI GCWGC 3 cut(s) 348, 639, 651
ApoI RAATTY 2 cut(s) 543, 577
ArsI GACNNNNNNTTYG 2 cut(s) 479, 511
AspLEI GCGC 3 cut(s) 22, 353, 651
AspS9I GGNCC 5 cut(s) 33, 240, 418, 427, 529
AsuHPI GGTGA 5 cut(s) 59, 317, 455, 562, 577
AvaII GGWCC 1 cut(s) 240
AxyI CCTNAGG 1 cut(s) 71
BanI GGYRCC 1 cut(s) 19
BanII GRGCYC 1 cut(s) 188
BbsI GAAGAC 1 cut(s) 287
Bbv12I GWGCWC 1 cut(s) 325
BbvI GCAGC 3 cut(s) 360, 626, 638
BccI CCATC 5 cut(s) 38, 74, 395, 434, 506
BcgI CGANNNNNNTGC 2 cut(s) 325, 359
BciT130I CCWGG 2 cut(s) 37, 149
BcoDI GTCTC 3 cut(s) 526, 531, 565
BfaI CTAG 3 cut(s) 372, 468, 501
BfmI CTRYAG 1 cut(s) 361
BfoI RGCGCY 2 cut(s) 23, 652
BglI GCCNNNNNGGC 1 cut(s) 426
BisI GCNGC 5 cut(s) 18, 349, 640, 652, 672
BlsI GCNGC 5 cut(s) 19, 350, 641, 653, 673
Bme1390I CCNGG 2 cut(s) 37, 149
Bme18I GGWCC 1 cut(s) 240
BmgT120I GGNCC 5 cut(s) 33, 240, 418, 427, 529
BmiI GGNNCC 2 cut(s) 21, 242
BmrFI CCNGG 2 cut(s) 37, 149
BmsI GCATC 2 cut(s) 220, 358
BpiI GAAGAC 1 cut(s) 287
Bpu10I CCTNAGC 1 cut(s) 286
BpuEI CTTGAG 1 cut(s) 671
BsaHI GRCGYC 2 cut(s) 20, 292
BsaI GGTCTC 1 cut(s) 526
BsaJI CCNNGG 3 cut(s) 36, 299, 455
BsaWI WCCGGW 1 cut(s) 62
BsaXI ACNNNNNCTCC 2 cut(s) 75, 105
Bsc4I CCNNNNNNNGG 4 cut(s) 76, 249, 250, 436
Bse1I ACTGG 4 cut(s) 194, 214, 242, 441
Bse21I CCTNAGG 1 cut(s) 71
BseBI CCWGG 2 cut(s) 37, 149
BseDI CCNNGG 3 cut(s) 36, 299, 455
BseGI GGATG 6 cut(s) 85, 235, 373, 445, 451, 517
BseLI CCNNNNNNNGG 4 cut(s) 76, 249, 250, 436
BseMII CTCAG 2 cut(s) 66, 395
BseNI ACTGG 4 cut(s) 194, 214, 242, 441
BseRI GAGGAG 3 cut(s) 583, 602, 617
BseXI GCAGC 3 cut(s) 360, 626, 638
BshFI GGCC 4 cut(s) 35, 420, 429, 530
BshNI GGYRCC 1 cut(s) 19
BsiHKAI GWGCWC 1 cut(s) 325
BsiSI CCGG 2 cut(s) 63, 312
BslI CCNNNNNNNGG 4 cut(s) 76, 249, 250, 436
BsmAI GTCTC 3 cut(s) 526, 531, 565
BsnI GGCC 4 cut(s) 35, 420, 429, 530
Bso31I GGTCTC 1 cut(s) 526
Bsp1286I GDGCHC 2 cut(s) 188, 325
Bsp143I GATC 4 cut(s) 159, 167, 558, 592
BspACI CCGC 4 cut(s) 17, 87, 263, 671
BspANI GGCC 4 cut(s) 35, 420, 429, 530
BspCNI CTCAG 2 cut(s) 65, 394
BspLI GGNNCC 2 cut(s) 21, 242
BspMAI CTGCAG 1 cut(s) 365
BspPI GGATC 2 cut(s) 566, 600
BspT107I GGYRCC 1 cut(s) 19
BspTNI GGTCTC 1 cut(s) 526
BsrI ACTGG 4 cut(s) 194, 214, 242, 441
BssECI CCNNGG 3 cut(s) 36, 299, 455
BssMI GATC 4 cut(s) 159, 167, 558, 592
BssNI GRCGYC 2 cut(s) 20, 292
BssT1I CCWWGG 1 cut(s) 455
Bst2UI CCWGG 2 cut(s) 37, 149
Bst4CI ACNGT 1 cut(s) 332
Bst6I CTCTTC 1 cut(s) 689
BstACI GRCGYC 2 cut(s) 20, 292
BstC8I GCNNGC 2 cut(s) 8, 283
BstDEI CTNAG 4 cut(s) 52, 71, 286, 381
BstDSI CCRYGG 1 cut(s) 299
BstEII GGTNACC 1 cut(s) 65
BstENI CCTNNNNNAGG 1 cut(s) 74
BstF5I GGATG 6 cut(s) 85, 235, 373, 445, 451, 517
BstH2I RGCGCY 2 cut(s) 23, 652
BstHHI GCGC 3 cut(s) 22, 353, 651
BstKTI GATC 4 cut(s) 162, 170, 561, 595
BstMAI GTCTC 3 cut(s) 526, 531, 565
BstMBI GATC 4 cut(s) 159, 167, 558, 592
BstMWI GCNNNNNNNGC 2 cut(s) 426, 648
BstNI CCWGG 2 cut(s) 37, 149
BstPI GGTNACC 1 cut(s) 65
BstSCI CCNGG 2 cut(s) 35, 147
BstSFI CTRYAG 1 cut(s) 361
BstV1I GCAGC 3 cut(s) 360, 626, 638
BstV2I GAAGAC 1 cut(s) 287
BstX2I RGATCY 2 cut(s) 558, 592
BstXI CCANNNNNNTGG 1 cut(s) 30
BstYI RGATCY 2 cut(s) 558, 592
Bsu36I CCTNAGG 1 cut(s) 71
BsuRI GGCC 4 cut(s) 35, 420, 429, 530
BtgI CCRYGG 1 cut(s) 299
BtsCI GGATG 6 cut(s) 85, 235, 373, 445, 451, 517
BtsI GCAGTG 1 cut(s) 674
BtsIMutI CAGTG 2 cut(s) 201, 674
Cac8I GCNNGC 2 cut(s) 8, 283
CfoI GCGC 3 cut(s) 22, 353, 651
Cfr13I GGNCC 5 cut(s) 33, 240, 418, 427, 529
CseI GACGC 1 cut(s) 281
CviAII CATG 1 cut(s) 337
DdeI CTNAG 4 cut(s) 52, 71, 286, 381
DinI GGCGCC 1 cut(s) 21
DpnI GATC 4 cut(s) 161, 169, 560, 594
DpnII GATC 4 cut(s) 159, 167, 558, 592
Eam1104I CTCTTC 1 cut(s) 689
EarI CTCTTC 1 cut(s) 689
EciI GGCGGA 2 cut(s) 102, 278
Eco130I CCWWGG 1 cut(s) 455
Eco24I GRGCYC 1 cut(s) 188
Eco31I GGTCTC 1 cut(s) 526
Eco47I GGWCC 1 cut(s) 240
Eco47III AGCGCT 1 cut(s) 650
Eco81I CCTNAGG 1 cut(s) 71
Eco91I GGTNACC 1 cut(s) 65
EcoNI CCTNNNNNAGG 1 cut(s) 74
EcoO65I GGTNACC 1 cut(s) 65
EcoRII CCWGG 2 cut(s) 35, 147
EcoT14I CCWWGG 1 cut(s) 455
EcoT38I GRGCYC 1 cut(s) 188
EgeI GGCGCC 1 cut(s) 21
EheI GGCGCC 1 cut(s) 21
ErhI CCWWGG 1 cut(s) 455
FaeI CATG 1 cut(s) 340
FaiI YATR 8 cut(s) 31, 155, 176, 182, 190, 338, 476, 527
FatI CATG 1 cut(s) 336
Fnu4HI GCNGC 5 cut(s) 18, 349, 640, 652, 672
FokI GGATG 6 cut(s) 92, 242, 380, 438, 452, 524
FriOI GRGCYC 1 cut(s) 188
Fsp4HI GCNGC 5 cut(s) 18, 349, 640, 652, 672
FspBI CTAG 3 cut(s) 372, 468, 501
GlaI GCGC 3 cut(s) 21, 352, 650
GluI GCNGC 5 cut(s) 18, 349, 640, 652, 672
HaeII RGCGCY 2 cut(s) 23, 652
HaeIII GGCC 4 cut(s) 35, 420, 429, 530
HapII CCGG 2 cut(s) 63, 312
HgaI GACGC 1 cut(s) 281
HhaI GCGC 3 cut(s) 22, 353, 651
Hin1I GRCGYC 2 cut(s) 20, 292
Hin1II CATG 1 cut(s) 340
Hin6I GCGC 3 cut(s) 20, 351, 649
HinP1I GCGC 3 cut(s) 20, 351, 649
HinfI GANTC 2 cut(s) 266, 377
HpaII CCGG 2 cut(s) 63, 312
HphI GGTGA 5 cut(s) 59, 317, 455, 562, 577
Hpy188I TCNGA 1 cut(s) 115
Hpy188III TCNNGA 2 cut(s) 596, 688
HpyAV CCTTC 3 cut(s) 70, 601, 616
HpyCH4III ACNGT 1 cut(s) 332
HpyCH4IV ACGT 1 cut(s) 106
HpyCH4V TGCA 2 cut(s) 363, 478
HpyF10VI GCNNNNNNNGC 2 cut(s) 426, 648
HpyF3I CTNAG 4 cut(s) 52, 71, 286, 381
HpySE526I ACGT 1 cut(s) 106
Hsp92I GRCGYC 2 cut(s) 20, 292
Hsp92II CATG 1 cut(s) 340
HspAI GCGC 3 cut(s) 20, 351, 649
KasI GGCGCC 1 cut(s) 19
Kzo9I GATC 4 cut(s) 159, 167, 558, 592
Lsp1109I GCAGC 3 cut(s) 360, 626, 638
LweI GCATC 2 cut(s) 220, 358
MaeI CTAG 3 cut(s) 372, 468, 501
MaeII ACGT 1 cut(s) 106
MaeIII GTNAC 2 cut(s) 65, 326
MalI GATC 4 cut(s) 161, 169, 560, 594
MboI GATC 4 cut(s) 159, 167, 558, 592
MboII GAAGA 3 cut(s) 89, 287, 706
MfeI CAATTG 1 cut(s) 422
MflI RGATCY 2 cut(s) 558, 592
MhlI GDGCHC 2 cut(s) 188, 325
MluCI AATT 5 cut(s) 422, 543, 577, 703, 709
Mly113I GGCGCC 1 cut(s) 20
MmeI TCCRAC 1 cut(s) 489
MseI TTAA 2 cut(s) 582, 712
MslI CAYNNNNRTG 1 cut(s) 105
MspI CCGG 2 cut(s) 63, 312
MspR9I CCNGG 2 cut(s) 37, 149
MunI CAATTG 1 cut(s) 422
MvaI CCWGG 2 cut(s) 37, 149
MwoI GCNNNNNNNGC 2 cut(s) 426, 648
NarI GGCGCC 1 cut(s) 20
NdeII GATC 4 cut(s) 159, 167, 558, 592
NlaIII CATG 1 cut(s) 340
NlaIV GGNNCC 2 cut(s) 21, 242
NmuCI GTSAC 1 cut(s) 65
PfeI GAWTC 2 cut(s) 266, 377
PkrI GCNGC 5 cut(s) 19, 350, 641, 653, 673
PluTI GGCGCC 1 cut(s) 23
Psp6I CCWGG 2 cut(s) 35, 147
PspEI GGTNACC 1 cut(s) 65
PspGI CCWGG 2 cut(s) 35, 147
PspN4I GGNNCC 2 cut(s) 21, 242
PspPI GGNCC 5 cut(s) 33, 240, 418, 427, 529
PstI CTGCAG 1 cut(s) 365
PsuI RGATCY 2 cut(s) 558, 592
RseI CAYNNNNRTG 1 cut(s) 105
SaqAI TTAA 2 cut(s) 582, 712
SatI GCNGC 5 cut(s) 18, 349, 640, 652, 672
Sau3AI GATC 4 cut(s) 159, 167, 558, 592
Sau96I GGNCC 5 cut(s) 33, 240, 418, 427, 529
ScrFI CCNGG 2 cut(s) 37, 149
SduI GDGCHC 2 cut(s) 188, 325
SetI ASST 8 cut(s) 58, 72, 109, 319, 387, 495, 557, 641
SfaNI GCATC 2 cut(s) 220, 358
SfcI CTRYAG 1 cut(s) 361
SfiI GGCCNNNNNGGCC 1 cut(s) 426
SfoI GGCGCC 1 cut(s) 21
SinI GGWCC 1 cut(s) 240
SmiMI CAYNNNNRTG 1 cut(s) 105
SmlI CTYRAG 1 cut(s) 686
SmoI CTYRAG 1 cut(s) 686
Sse9I AATT 5 cut(s) 422, 543, 577, 703, 709
SsiI CCGC 4 cut(s) 17, 87, 263, 671
SspDI GGCGCC 1 cut(s) 19
SspMI CTAG 3 cut(s) 372, 468, 501
StyD4I CCNGG 2 cut(s) 35, 147
StyI CCWWGG 1 cut(s) 455
TaaI ACNGT 1 cut(s) 332
TaiI ACGT 1 cut(s) 109
TaqI TCGA 2 cut(s) 123, 136
TasI AATT 5 cut(s) 422, 543, 577, 703, 709
TauI GCSGC 2 cut(s) 20, 674
TfiI GAWTC 2 cut(s) 266, 377
Tru1I TTAA 2 cut(s) 582, 712
Tru9I TTAA 2 cut(s) 582, 712
TscAI CASTG 2 cut(s) 201, 681
TseFI GTSAC 1 cut(s) 65
TseI GCWGC 3 cut(s) 348, 639, 651
Tsp45I GTSAC 1 cut(s) 65
TspDTI ATGAA 2 cut(s) 83, 89
TspGWI ACGGA 1 cut(s) 288
TspRI CASTG 2 cut(s) 201, 681
VpaK11BI GGWCC 1 cut(s) 240
XagI CCTNNNNNAGG 1 cut(s) 74
XapI RAATTY 2 cut(s) 543, 577
XspI CTAG 3 cut(s) 372, 468, 501
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.