Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0001644.1

Orthogroup ID

OG0006252

Physical Location & Seq

Genomic Coordinates Reverse (-)

106821 .. 108014

Gene Structure 1194 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0001644.1_g000021.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 573 bp

atgagtcatgctgaagaggcatctgaatttgcaaacaagttgatggcattaacatttgccgaggaagatgcattagtagctagcaggggattagaagttgcagctgctaatctgagggactactgctacaaattggagaggaaactgctagctcgttttgaagtgtatcacagagaagagatcgacttgtctgacatggatgaatatcttgaatatgagcagacttctcttagacacctatatcaagctaagatggaagaactacatgctgaaagacaacatattgtaacagaatttatccattggaatgaagaagcaatcaccagattcaccactttgttttcatctcaccctgcaaaccttgcagcgaatgcaaaagcggtattcacttccctactggaccaagttactcaatatttaaccgaagtacagcgttgctgtagtagtgtggcaatagttcaacaccacttttcaacttctgtatctcggcttctgctcactgtggctgctgcacatgctgctgcatgtgaagaaatcagattggctatgtcaagtgcagagagggctacatga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0000145 GO:0005575 GO:0005576 GO:0005615 GO:0005622 GO:0005623 GO:0005737 GO:0005829 GO:0005938 GO:0006810 GO:0006887 GO:0006892 GO:0006893 GO:0008150 GO:0009987 GO:0016192 GO:0031982 GO:0032940 GO:0032991 GO:0043226 GO:0043227 GO:0043230 GO:0044421 GO:0044424 GO:0044444 GO:0044448 GO:0044464 GO:0046903 GO:0048193 GO:0051179 GO:0051234 GO:0070062 GO:0071944 GO:0098876 GO:0099023 GO:0099568 GO:1903561

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Sec10

Protein Analysis

190

Amino Acids

21.6

Weight (kDa)

5.24

Isoelectric Point (pI)

46.08

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0006252)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT5G12370 AT5G12370 AT5G12370
fragaria_vesca	FvH4_7g15330 FvH4_7g15330 FvH4_7g15330 FvH4_7g15330
malus_domestica	MD01G1071200.v1.1 MD07G1131500.v1.1
prunus_persica	Prupe.2G177200_v2.0.a1
pyrus_communis	pycom01g10010 pycom07g12840
rosa_chinensis	RchiOBHm_Chr1g0357661 RchiOBHm_Chr1g0375651 RchiOBHm_Chr1g0375661
rosa_laevigata	RLG00000028010
rosa_multiflora	Rmu_sc0001644.1_g000021 Rmu_sc0004683.1_g000003
rosa_roxburghii	Rroxscaffold_4G00282690 Rroxscaffold_4G00298660
rosa_rugosa	Rorug01G0257500
rosa_samantha	Rh1AG271500 Rh1AG402900 Rh1BG238400 Rh1CG255300 Rh1DG266700
rosa_wichuraiana	Rw1G024200

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AciI	CCGC	1 cut(s)	380
AcsI	RAATTY	2 cut(s)	26, 293
AcuI	CTGAAG	1 cut(s)	33
AfaI	GTAC	1 cut(s)	429
AgsI	TTSAA	4 cut(s)	161, 212, 461, 474
AluBI	AGCT	4 cut(s)	80, 104, 152, 248
AluI	AGCT	4 cut(s)	80, 104, 152, 248
ApeKI	GCWGC	7 cut(s)	101, 104, 365, 506, 509, 518, 521
ApoI	RAATTY	2 cut(s)	26, 293
AspS9I	GGNCC	1 cut(s)	400
AsuHPI	GGTGA	3 cut(s)	313, 322, 341
AsuNHI	GCTAGC	2 cut(s)	80, 148
AvaII	GGWCC	1 cut(s)	400
BaeI	ACNNNNGTAYC	2 cut(s)	465, 498
BarI	GAAGNNNNNNTAC	2 cut(s)	474, 506
BbvI	GCAGC	7 cut(s)	91, 113, 377, 493, 496, 505, 508
BccI	CCATC	2 cut(s)	37, 247
BcgI	CGANNNNNNTGC	2 cut(s)	50, 84
BfaI	CTAG	2 cut(s)	81, 149
BfmI	CTRYAG	1 cut(s)	439
BisI	GCNGC	7 cut(s)	102, 105, 366, 507, 510, 519, 522
BlsI	GCNGC	7 cut(s)	103, 106, 367, 508, 511, 520, 523
Bme18I	GGWCC	1 cut(s)	400
BmgT120I	GGNCC	1 cut(s)	400
BmsI	GCATC	2 cut(s)	29, 58
BmtI	GCTAGC	2 cut(s)	84, 152
BsaBI	GATNNNNATC	1 cut(s)	204
BsaJI	CCNNGG	1 cut(s)	60
Bse1I	ACTGG	1 cut(s)	402
Bse8I	GATNNNNATC	1 cut(s)	204
BseDI	CCNNGG	1 cut(s)	60
BseGI	GGATG	1 cut(s)	205
BseJI	GATNNNNATC	1 cut(s)	204
BseMII	CTCAG	1 cut(s)	104
BseNI	ACTGG	1 cut(s)	402
BseXI	GCAGC	7 cut(s)	91, 113, 377, 493, 496, 505, 508
BsgI	GTGCAG	1 cut(s)	495
BslFI	GGGAC	1 cut(s)	131
BsmFI	GGGAC	1 cut(s)	131
BsmI	GAATGC	1 cut(s)	376
Bsp143I	GATC	1 cut(s)	180
BspACI	CCGC	1 cut(s)	380
BspCNI	CTCAG	1 cut(s)	105
BspOI	GCTAGC	2 cut(s)	84, 152
BsrI	ACTGG	1 cut(s)	402
BssECI	CCNNGG	1 cut(s)	60
BssMI	GATC	1 cut(s)	180
Bst4CI	ACNGT	1 cut(s)	502
Bst6I	CTCTTC	2 cut(s)	9, 171
BstAPI	GCANNNNNTGC	3 cut(s)	362, 371, 518
BstC8I	GCNNGC	2 cut(s)	82, 150
BstDEI	CTNAG	3 cut(s)	113, 230, 249
BstF5I	GGATG	1 cut(s)	205
BstKTI	GATC	1 cut(s)	183
BstMBI	GATC	1 cut(s)	180
BstMWI	GCNNNNNNNGC	7 cut(s)	17, 77, 362, 371, 515, 518, 563
BstNSI	RCATGY	3 cut(s)	269, 518, 528
BstSFI	CTRYAG	1 cut(s)	439
BstV1I	GCAGC	7 cut(s)	91, 113, 377, 493, 496, 505, 508
BtsCI	GGATG	1 cut(s)	205
BtsIMutI	CAGTG	1 cut(s)	498
Cac8I	GCNNGC	2 cut(s)	82, 150
Cfr13I	GGNCC	1 cut(s)	400
Csp6I	GTAC	1 cut(s)	428
CviAII	CATG	6 cut(s)	8, 196, 266, 515, 525, 570
CviJI	RGCY	8 cut(s)	80, 104, 152, 248, 490, 506, 545, 566
CviKI_1	RGCY	8 cut(s)	80, 104, 152, 248, 490, 506, 545, 566
CviQI	GTAC	1 cut(s)	428
DdeI	CTNAG	3 cut(s)	113, 230, 249
DpnI	GATC	1 cut(s)	182
DpnII	GATC	1 cut(s)	180
Eam1104I	CTCTTC	2 cut(s)	9, 171
EarI	CTCTTC	2 cut(s)	9, 171
Eco47I	GGWCC	1 cut(s)	400
Eco57I	CTGAAG	1 cut(s)	33
EcoT22I	ATGCAT	1 cut(s)	73
FaeI	CATG	6 cut(s)	11, 199, 269, 518, 528, 573
FaqI	GGGAC	1 cut(s)	131
FatI	CATG	6 cut(s)	7, 195, 265, 514, 524, 569
Fnu4HI	GCNGC	7 cut(s)	102, 105, 366, 507, 510, 519, 522
FokI	GGATG	1 cut(s)	212
Fsp4HI	GCNGC	7 cut(s)	102, 105, 366, 507, 510, 519, 522
FspBI	CTAG	2 cut(s)	81, 149
GluI	GCNGC	7 cut(s)	102, 105, 366, 507, 510, 519, 522
Hin1II	CATG	6 cut(s)	11, 199, 269, 518, 528, 573
HinfI	GANTC	2 cut(s)	4, 327
HphI	GGTGA	3 cut(s)	313, 322, 341
Hpy188I	TCNGA	4 cut(s)	25, 114, 193, 539
Hpy188III	TCNNGA	1 cut(s)	209
HpyCH4III	ACNGT	1 cut(s)	502
HpyCH4V	TGCA	9 cut(s)	32, 71, 101, 356, 365, 374, 512, 524, 557
HpyF10VI	GCNNNNNNNGC	7 cut(s)	17, 77, 362, 371, 515, 518, 563
HpyF3I	CTNAG	3 cut(s)	113, 230, 249
Hsp92II	CATG	6 cut(s)	11, 199, 269, 518, 528, 573
Kzo9I	GATC	1 cut(s)	180
LpnPI	CCDG	4 cut(s)	70, 337, 366, 383
Lsp1109I	GCAGC	7 cut(s)	91, 113, 377, 493, 496, 505, 508
LweI	GCATC	2 cut(s)	29, 58
MaeI	CTAG	2 cut(s)	81, 149
MaeIII	GTNAC	2 cut(s)	286, 406
MalI	GATC	1 cut(s)	182
MboI	GATC	1 cut(s)	180
MboII	GAAGA	6 cut(s)	26, 77, 188, 269, 323, 542
MluCI	AATT	3 cut(s)	26, 131, 293
MlyI	GAGTC	1 cut(s)	13
MnlI	CCTC	5 cut(s)	10, 55, 108, 132, 555
Mph1103I	ATGCAT	1 cut(s)	73
MseI	TTAA	2 cut(s)	50, 419
MslI	CAYNNNNRTG	1 cut(s)	306
MspA1I	CMGCKG	1 cut(s)	104
Mva1269I	GAATGC	1 cut(s)	376
MwoI	GCNNNNNNNGC	7 cut(s)	17, 77, 362, 371, 515, 518, 563
NdeII	GATC	1 cut(s)	180
NheI	GCTAGC	2 cut(s)	80, 148
NlaIII	CATG	6 cut(s)	11, 199, 269, 518, 528, 573
NmeAIII	GCCGAG	2 cut(s)	85, 466
NsiI	ATGCAT	1 cut(s)	73
NspI	RCATGY	3 cut(s)	269, 518, 528
PctI	GAATGC	1 cut(s)	376
PfeI	GAWTC	1 cut(s)	327
PkrI	GCNGC	7 cut(s)	103, 106, 367, 508, 511, 520, 523
PleI	GAGTC	1 cut(s)	12
PpsI	GAGTC	1 cut(s)	12
PspPI	GGNCC	1 cut(s)	400
PvuII	CAGCTG	1 cut(s)	104
RsaI	GTAC	1 cut(s)	429
RsaNI	GTAC	1 cut(s)	428
RseI	CAYNNNNRTG	1 cut(s)	306
SaqAI	TTAA	2 cut(s)	50, 419
SatI	GCNGC	7 cut(s)	102, 105, 366, 507, 510, 519, 522
Sau3AI	GATC	1 cut(s)	180
Sau96I	GGNCC	1 cut(s)	400
SchI	GAGTC	1 cut(s)	13
SetI	ASST	6 cut(s)	82, 106, 154, 240, 250, 363
SfaNI	GCATC	2 cut(s)	29, 58
SfcI	CTRYAG	1 cut(s)	439
SinI	GGWCC	1 cut(s)	400
SmiMI	CAYNNNNRTG	1 cut(s)	306
Sse9I	AATT	3 cut(s)	26, 131, 293
SsiI	CCGC	1 cut(s)	380
SspI	AATATT	1 cut(s)	416
SspMI	CTAG	2 cut(s)	81, 149
TaaI	ACNGT	1 cut(s)	502
TaqI	TCGA	1 cut(s)	183
TasI	AATT	3 cut(s)	26, 131, 293
TatI	WGTACW	1 cut(s)	427
TfiI	GAWTC	1 cut(s)	327
Tru1I	TTAA	2 cut(s)	50, 419
Tru9I	TTAA	2 cut(s)	50, 419
TscAI	CASTG	1 cut(s)	505
TseI	GCWGC	7 cut(s)	101, 104, 365, 506, 509, 518, 521
TspDTI	ATGAA	3 cut(s)	216, 324, 333
TspRI	CASTG	1 cut(s)	505
VpaK11BI	GGWCC	1 cut(s)	400
XapI	RAATTY	2 cut(s)	26, 293
XceI	RCATGY	3 cut(s)	269, 518, 528
XspI	CTAG	2 cut(s)	81, 149
Zsp2I	ATGCAT	1 cut(s)	73

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.