Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0002087.1

Orthogroup ID

OG0006921

Physical Location & Seq

Genomic Coordinates Forward (+)

36163 .. 37598

Gene Structure 1436 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0002087.1_g000007.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 1281 bp

atggttgtttccttgttgcttctggccttccctggcttccttaaacgttggttatctgatcccatgatattacaaattgaagaataccatggtatgagtagtcgcaatcaacttttcggtgctttggagctttacttgcagaacaagatcagcccctccactcgacttctcaaaattgcacaaactcggaaagatggtattttcagcacccacttttcagataggcaagagtttgaggatgtgtatgaagatattcagctcaagtggaagttcaatatcatatctaaggagtccaatcatccttctttatcatccaagagaaagcaatactttgagcttatatttgacttagaacaccaggaaaaggtcatgaattcttacttgccttatgttttggagagatttaaggccatgaaggaggaaagaaagcttgtcaagctgcatacccttgcaaggttagatccttttaaaatcaaatgggatgcaatctatctcgaacaccctgcaacgtttgaaacgctagccatggatttggagctgaagacagctgttttggaggatttggaaaagtttgttaagaggaaagagttctatcaaaaagtgggaagggcttggaagcgagggtatcttttatttggtcctccaggcactggtaaatcgtcgcttgttgctgccatagctaattacctcaagtttgatatctatgatttgcagctcacacatttgaaatcagatatggaattgagaaaagcattgattgcaacaacaaataaatctatacttgtgattgaggatattgattgtagtcaggcggagctgcaagatcgaaactatggtaagggcagtaagaaaaatgagtcagaaggccagcagattacgctatctggactactaaacttcacagatggcctgtggtctagttgtggagaagaaagaatcttcatattcactaccaatcacaagagcaaactagaccctgcattgctccgatcaggacgaatggacatgcacatccacatgtcgtattgctcgtatgagggctttaaaacattggcctcaaattacctgggaatttgtggacaccaccccttatttgagaagattgaaagcctgctaaaaaatacaaaggtcactcctgcacaagtcgctgaggcgctaatgaagagtgaggatgctgaagtagcactccagggtctgatcactctgctaaaggaaaagagatacaagggggatgagtaccgagatgaaggtgcagaggagaatctaacatattttatttag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

AAA AAA_assoc

Protein Analysis

426

Amino Acids

49.3

Weight (kDa)

7.2

Isoelectric Point (pI)

42.42

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0006921)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_3g12400 FvH4_3g12400 FvH4_3g12400 FvH4_3g12400 FvH4_3g12402
malus_domestica	MD05G1250600.v1.1
prunus_persica	Prupe.4G113000_v2.0.a1
pyrus_communis	pycom05g22850
rosa_chinensis	RchiOBHm_Chr5g0020271 RchiOBHm_Chr5g0020291
rosa_laevigata	RLG00000032514 RLG00000032515
rosa_multiflora	Rmu_sc0002087.1_g000006 Rmu_sc0002087.1_g000007
rosa_roxburghii	Rroxscaffold_1G00057930 Rroxscaffold_1G00057940
rosa_rugosa	Rorug05G0058100 Rorug05G0058200 Rorug05G0058300
rosa_samantha	Rh5AG148600 Rh5AG148700 Rh5BG148100 Rh5CG159500 Rh5CG159800
rosa_wichuraiana	Rw5G013150 Rw5G013170

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB7I	CCANNNNNTGG	1 cut(s)	650
AciI	CCGC	1 cut(s)	812
AclI	AACGTT	2 cut(s)	46, 509
AclWI	GGATC	2 cut(s)	53, 455
AcsI	RAATTY	2 cut(s)	373, 1071
AcuI	CTGAAG	2 cut(s)	560, 1197
AfaI	GTAC	1 cut(s)	1238
AfiI	CCNNNNNNNGG	3 cut(s)	364, 453, 650
AflIII	ACRYGT	1 cut(s)	1017
AgsI	TTSAA	5 cut(s)	80, 274, 515, 727, 1106
AjnI	CCWGG	5 cut(s)	31, 357, 643, 1065, 1188
AlwI	GGATC	2 cut(s)	53, 455
AlwNI	CAGNNNCTG	2 cut(s)	650, 1195
AoxI	GGCC	5 cut(s)	24, 408, 865, 907, 1053
ApeKI	GCWGC	4 cut(s)	439, 671, 712, 817
ApoI	RAATTY	2 cut(s)	373, 1071
ArsI	GACNNNNNNTTYG	2 cut(s)	535, 567
Asp700I	GAANNNNTTC	2 cut(s)	252, 587
AspLEI	GCGC	1 cut(s)	1156
AspS9I	GGNCC	1 cut(s)	638
AsuNHI	GCTAGC	1 cut(s)	520
AvaII	GGWCC	1 cut(s)	638
BbsI	GAAGAC	1 cut(s)	548
BbvCI	CCTCAGC	1 cut(s)	1149
BbvI	GCAGC	4 cut(s)	426, 658, 724, 804
BccI	CCATC	2 cut(s)	188, 899
BcgI	CGANNNNNNTGC	2 cut(s)	485, 519
BciT130I	CCWGG	5 cut(s)	33, 359, 645, 1067, 1190
BclI	TGATCA	1 cut(s)	1197
BfaI	CTAG	3 cut(s)	521, 918, 971
BfoI	RGCGCY	1 cut(s)	1157
BisI	GCNGC	4 cut(s)	440, 672, 713, 818
BlsI	GCNGC	4 cut(s)	441, 673, 714, 819
Bme1390I	CCNGG	5 cut(s)	33, 359, 645, 1067, 1190
Bme18I	GGWCC	1 cut(s)	638
BmgT120I	GGNCC	1 cut(s)	638
BmrFI	CCNGG	5 cut(s)	33, 359, 645, 1067, 1190
BmsI	GCATC	2 cut(s)	472, 1162
BmtI	GCTAGC	1 cut(s)	524
BpiI	GAAGAC	1 cut(s)	548
BpmI	CTGGAG	2 cut(s)	627, 1172
Bpu10I	CCTNAGC	1 cut(s)	1149
BpuEI	CTTGAG	2 cut(s)	245, 674
BsaJI	CCNNGG	5 cut(s)	31, 88, 525, 1066, 1189
Bsc4I	CCNNNNNNNGG	3 cut(s)	364, 453, 650
Bse1I	ACTGG	1 cut(s)	655
Bse3DI	GCAATG	1 cut(s)	980
BseBI	CCWGG	5 cut(s)	33, 359, 645, 1067, 1190
BseDI	CCNNGG	5 cut(s)	31, 88, 525, 1066, 1189
BseGI	GGATG	7 cut(s)	244, 298, 311, 487, 1011, 1177, 1237
BseLI	CCNNNNNNNGG	3 cut(s)	364, 453, 650
BseMI	GCAATG	1 cut(s)	980
BseMII	CTCAG	1 cut(s)	1140
BseNI	ACTGG	1 cut(s)	655
BseRI	GAGGAG	1 cut(s)	1271
BseXI	GCAGC	4 cut(s)	426, 658, 724, 804
BsgI	GTGCAG	2 cut(s)	1122, 1272
BshFI	GGCC	5 cut(s)	26, 410, 867, 909, 1055
BslI	CCNNNNNNNGG	3 cut(s)	364, 453, 650
BsnI	GGCC	5 cut(s)	26, 410, 867, 909, 1055
Bsp143I	GATC	6 cut(s)	58, 147, 460, 823, 989, 1197
Bsp19I	CCATGG	2 cut(s)	88, 525
BspACI	CCGC	1 cut(s)	812
BspANI	GGCC	5 cut(s)	26, 410, 867, 909, 1055
BspCNI	CTCAG	1 cut(s)	1141
BspHI	TCATGA	1 cut(s)	369
BspOI	GCTAGC	1 cut(s)	524
BspPI	GGATC	2 cut(s)	53, 455
BsrDI	GCAATG	1 cut(s)	980
BsrI	ACTGG	1 cut(s)	655
BssECI	CCNNGG	5 cut(s)	31, 88, 525, 1066, 1189
BssMI	GATC	6 cut(s)	58, 147, 460, 823, 989, 1197
BssT1I	CCWWGG	2 cut(s)	88, 525
Bst2UI	CCWGG	5 cut(s)	33, 359, 645, 1067, 1190
Bst6I	CTCTTC	1 cut(s)	1157
BstAPI	GCANNNNNTGC	1 cut(s)	758
BstC8I	GCNNGC	3 cut(s)	522, 869, 1112
BstDEI	CTNAG	3 cut(s)	285, 349, 1149
BstDSI	CCRYGG	2 cut(s)	88, 525
BstF5I	GGATG	7 cut(s)	244, 298, 311, 487, 1011, 1177, 1237
BstH2I	RGCGCY	1 cut(s)	1157
BstHHI	GCGC	1 cut(s)	1156
BstKTI	GATC	6 cut(s)	61, 150, 463, 826, 992, 1200
BstMBI	GATC	6 cut(s)	58, 147, 460, 823, 989, 1197
BstMWI	GCNNNNNNNGC	7 cut(s)	136, 436, 677, 758, 877, 1145, 1181
BstNI	CCWGG	5 cut(s)	33, 359, 645, 1067, 1190
BstNSI	RCATGY	2 cut(s)	1009, 1021
BstSCI	CCNGG	5 cut(s)	31, 357, 643, 1065, 1188
BstV1I	GCAGC	4 cut(s)	426, 658, 724, 804
BstV2I	GAAGAC	1 cut(s)	548
BstX2I	RGATCY	1 cut(s)	460
BstXI	CCANNNNNNTGG	1 cut(s)	532
BstYI	RGATCY	1 cut(s)	460
BsuRI	GGCC	5 cut(s)	26, 410, 867, 909, 1055
BtgI	CCRYGG	2 cut(s)	88, 525
BtsCI	GGATG	7 cut(s)	244, 298, 311, 487, 1011, 1177, 1237
BtsIMutI	CAGTG	1 cut(s)	648
Cac8I	GCNNGC	3 cut(s)	522, 869, 1112
CaiI	CAGNNNCTG	2 cut(s)	650, 1195
CciI	TCATGA	1 cut(s)	369
CfoI	GCGC	1 cut(s)	1156
Cfr13I	GGNCC	1 cut(s)	638
Csp6I	GTAC	1 cut(s)	1237
CviAII	CATG	7 cut(s)	64, 89, 370, 412, 526, 1006, 1018
CviQI	GTAC	1 cut(s)	1237
DdeI	CTNAG	3 cut(s)	285, 349, 1149
DpnI	GATC	6 cut(s)	60, 149, 462, 825, 991, 1199
DpnII	GATC	6 cut(s)	58, 147, 460, 823, 989, 1197
DraI	TTTAAA	2 cut(s)	469, 1045
Eam1104I	CTCTTC	1 cut(s)	1157
EarI	CTCTTC	1 cut(s)	1157
EciI	GGCGGA	1 cut(s)	827
Eco130I	CCWWGG	2 cut(s)	88, 525
Eco32I	GATATC	1 cut(s)	700
Eco47I	GGWCC	1 cut(s)	638
Eco57I	CTGAAG	2 cut(s)	560, 1197
EcoRI	GAATTC	1 cut(s)	373
EcoRII	CCWGG	5 cut(s)	31, 357, 643, 1065, 1188
EcoRV	GATATC	1 cut(s)	700
EcoT14I	CCWWGG	2 cut(s)	88, 525
ErhI	CCWWGG	2 cut(s)	88, 525
FaeI	CATG	7 cut(s)	67, 92, 373, 415, 529, 1009, 1021
FalI	AAGNNNNNCTT	2 cut(s)	314, 346
FatI	CATG	7 cut(s)	63, 88, 369, 411, 525, 1005, 1017
FbaI	TGATCA	1 cut(s)	1197
Fnu4HI	GCNGC	4 cut(s)	440, 672, 713, 818
FokI	GGATG	7 cut(s)	251, 285, 298, 494, 998, 1184, 1244
Fsp4HI	GCNGC	4 cut(s)	440, 672, 713, 818
FspBI	CTAG	3 cut(s)	521, 918, 971
GlaI	GCGC	1 cut(s)	1155
GluI	GCNGC	4 cut(s)	440, 672, 713, 818
GsuI	CTGGAG	2 cut(s)	627, 1172
HaeII	RGCGCY	1 cut(s)	1157
HaeIII	GGCC	5 cut(s)	26, 410, 867, 909, 1055
HhaI	GCGC	1 cut(s)	1156
Hin1II	CATG	7 cut(s)	67, 92, 373, 415, 529, 1009, 1021
Hin6I	GCGC	1 cut(s)	1154
HinP1I	GCGC	1 cut(s)	1154
HindIII	AAGCTT	1 cut(s)	428
HinfI	GANTC	4 cut(s)	290, 857, 936, 1261
Hpy166II	GTNNAC	1 cut(s)	1079
Hpy188I	TCNGA	7 cut(s)	58, 189, 220, 733, 862, 989, 1197
Hpy188III	TCNNGA	4 cut(s)	370, 494, 885, 993
Hpy8I	GTNNAC	1 cut(s)	1079
Hpy99I	CGWCG	1 cut(s)	664
HpyAV	CCTTC	6 cut(s)	37, 312, 409, 600, 857, 1241
HpyCH4IV	ACGT	2 cut(s)	46, 509
HpyF10VI	GCNNNNNNNGC	7 cut(s)	136, 436, 677, 758, 877, 1145, 1181
HpyF3I	CTNAG	3 cut(s)	285, 349, 1149
HpySE526I	ACGT	2 cut(s)	46, 509
Hsp92II	CATG	7 cut(s)	67, 92, 373, 415, 529, 1009, 1021
HspAI	GCGC	1 cut(s)	1154
Ksp22I	TGATCA	1 cut(s)	1197
Kzo9I	GATC	6 cut(s)	58, 147, 460, 823, 989, 1197
LmnI	GCTCC	4 cut(s)	127, 535, 814, 990
Lsp1109I	GCAGC	4 cut(s)	426, 658, 724, 804
LweI	GCATC	2 cut(s)	472, 1162
MaeI	CTAG	3 cut(s)	521, 918, 971
MaeII	ACGT	2 cut(s)	46, 509
MaeIII	GTNAC	1 cut(s)	1129
MalI	GATC	6 cut(s)	60, 149, 462, 825, 991, 1199
MboI	GATC	6 cut(s)	58, 147, 460, 823, 989, 1197
MboII	GAAGA	7 cut(s)	92, 260, 553, 931, 941, 1111, 1174
MflI	RGATCY	1 cut(s)	460
MluCI	AATT	7 cut(s)	75, 174, 373, 682, 740, 1060, 1071
MlyI	GAGTC	2 cut(s)	299, 866
MroXI	GAANNNNTTC	2 cut(s)	252, 587
MseI	TTAA	5 cut(s)	42, 405, 468, 576, 1044
MslI	CAYNNNNRTG	1 cut(s)	1016
MspA1I	CMGCKG	1 cut(s)	548
MspR9I	CCNGG	5 cut(s)	33, 359, 645, 1067, 1190
MvaI	CCWGG	5 cut(s)	33, 359, 645, 1067, 1190
MwoI	GCNNNNNNNGC	7 cut(s)	136, 436, 677, 758, 877, 1145, 1181
NcoI	CCATGG	2 cut(s)	88, 525
NdeII	GATC	6 cut(s)	58, 147, 460, 823, 989, 1197
NheI	GCTAGC	1 cut(s)	520
NlaIII	CATG	7 cut(s)	67, 92, 373, 415, 529, 1009, 1021
NmuCI	GTSAC	1 cut(s)	1129
NspI	RCATGY	2 cut(s)	1009, 1021
PagI	TCATGA	1 cut(s)	369
PciI	ACATGT	1 cut(s)	1017
PcsI	WCGNNNNNNNCGW	1 cut(s)	1028
PdmI	GAANNNNTTC	2 cut(s)	252, 587
PfeI	GAWTC	2 cut(s)	936, 1261
PflMI	CCANNNNNTGG	1 cut(s)	650
PkrI	GCNGC	4 cut(s)	441, 673, 714, 819
PleI	GAGTC	2 cut(s)	298, 865
PpsI	GAGTC	2 cut(s)	298, 865
PscI	ACATGT	1 cut(s)	1017
Psp1406I	AACGTT	2 cut(s)	46, 509
Psp6I	CCWGG	5 cut(s)	31, 357, 643, 1065, 1188
PspGI	CCWGG	5 cut(s)	31, 357, 643, 1065, 1188
PspPI	GGNCC	1 cut(s)	638
PstNI	CAGNNNCTG	2 cut(s)	650, 1195
PsuI	RGATCY	1 cut(s)	460
PvuII	CAGCTG	1 cut(s)	548
RsaI	GTAC	1 cut(s)	1238
RsaNI	GTAC	1 cut(s)	1237
RseI	CAYNNNNRTG	1 cut(s)	1016
SaqAI	TTAA	5 cut(s)	42, 405, 468, 576, 1044
SatI	GCNGC	4 cut(s)	440, 672, 713, 818
Sau3AI	GATC	6 cut(s)	58, 147, 460, 823, 989, 1197
Sau96I	GGNCC	1 cut(s)	638
SchI	GAGTC	2 cut(s)	299, 866
ScrFI	CCNGG	5 cut(s)	33, 359, 645, 1067, 1190
SfaNI	GCATC	2 cut(s)	472, 1162
SinI	GGWCC	1 cut(s)	638
SmiMI	CAYNNNNRTG	1 cut(s)	1016
SmlI	CTYRAG	2 cut(s)	260, 689
SmoI	CTYRAG	2 cut(s)	260, 689
Sse9I	AATT	7 cut(s)	75, 174, 373, 682, 740, 1060, 1071
SsiI	CCGC	1 cut(s)	812
SspMI	CTAG	3 cut(s)	521, 918, 971
StyD4I	CCNGG	5 cut(s)	31, 357, 643, 1065, 1188
StyI	CCWWGG	2 cut(s)	88, 525
TaiI	ACGT	2 cut(s)	49, 512
TaqI	TCGA	3 cut(s)	163, 495, 826
TasI	AATT	7 cut(s)	75, 174, 373, 682, 740, 1060, 1071
TfiI	GAWTC	2 cut(s)	936, 1261
Tru1I	TTAA	5 cut(s)	42, 405, 468, 576, 1044
Tru9I	TTAA	5 cut(s)	42, 405, 468, 576, 1044
TscAI	CASTG	1 cut(s)	655
TseFI	GTSAC	1 cut(s)	1129
TseI	GCWGC	4 cut(s)	439, 671, 712, 817
Tsp45I	GTSAC	1 cut(s)	1129
TspDTI	ATGAA	6 cut(s)	261, 386, 428, 931, 1175, 1260
TspRI	CASTG	1 cut(s)	655
Van91I	CCANNNNNTGG	1 cut(s)	650
VpaK11BI	GGWCC	1 cut(s)	638
XapI	RAATTY	2 cut(s)	373, 1071
XceI	RCATGY	2 cut(s)	1009, 1021
XmnI	GAANNNNTTC	2 cut(s)	252, 587
XspI	CTAG	3 cut(s)	521, 918, 971

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.