Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0002164.1

Orthogroup ID

OG0013668

Physical Location & Seq

Genomic Coordinates Forward (+)

73100 .. 75121

Gene Structure 2022 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

N/A

Sequence Viewer

CDS Protein Promoter (2k)

Length: 1287 bp

atgtcgcaatccagtagtccaatgaagaacttagatcctaaggattctcatggaatcttttcagccaaacatctcttctataactgtactgatgttgccttctccccttatggtgcttattgcaggcacattcgtaagatttgcatacttgagctactaagtgccaaaagagtgcaatcatttagtcatgtaagagcagaagacgttgctcgtctggctcatcgggttgcagagccctatcctggcaccactaatctgagcaagttgcttggactatatgcaaatgaacttctctgccacgtagcatttggaagagatttctcaggtggtggagagtatgatcagcatggtttccaaaagatgcttgaggaataccaggaattgcttggcagattttctattggagatttcttcccttctatggagtttctgcacaccttaacaggaatgaaatcaagacttcaagagacattcgggagattcgataaacaatttgaccagatgataactgaacatcaaaatcccaaaagagaaaaacaggagcacaaggaccccgtggatgttttactggatatacagaaaaaagattctgctgacatgcctctcaccatggataatgtcaaggctattatcttggacatgtttgccgcaggaactgacacaaccttcatcacccttgattggggaatgacagagcttttgatgaaccccaaagtcctggaaaaggcacaagctgaagtacaaggtgttgttggggaaagaagagtcgtattggagagtgatctgcatcatctggactacatgaaagctgtcatcaaagagatctatagattgcatccagcagcaccagtacttctccctagagaatgcatggaagatgtaaacattgatgggtatgatattccagccaaaacaagaatttctgtcaatgcctgggcaatagggagagacccagaatcttgggaaaacccagaaatgtttgaaccagaaagatttataggtagcactatcgatttcaaggggcaggactttgagcttataccttttggggctggtagaagaggttgtccagcgattacattcagcacagccagcattgagcttgctctagcacaacttctgcatagctttgattgggagcttcctgctggtactgcagctaaagagttggacttggccgaagcttttggcatcacaatgcgtaggatagccaatctgattgttgtagccagtggcggagggagaaatgtttttgagtgggggcaaaaaaaatttacaccaaaatag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0005783 GO:0005789 GO:0012505 GO:0016020 GO:0031090 GO:0031984 GO:0042175 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044422 GO:0044424 GO:0044425 GO:0044432 GO:0044444 GO:0044446 GO:0044464 GO:0098827

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

p450

Protein Analysis

428

Amino Acids

48.3

Weight (kDa)

5.66

Isoelectric Point (pI)

45.35

Instability Index

Protein Domains (Pfam)

Domain Name	Pfam ID	Position	E-value	Description
p450	PF00067	25 - 393	8.6e-82	Cytochrome P450

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0013668)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_5g06600
malus_domestica	MD14G1168600.v1.1
rosa_chinensis	RchiOBHm_Chr7g0192161
rosa_laevigata	RLG00000004391 RLG00000004392
rosa_multiflora	Rmu_co8367077.1_g000001 Rmu_co8395345.1_g000001 Rmu_sc0002164.1_g000020
rosa_roxburghii	Rroxscaffold_3G00263240 Rroxscaffold_3G00263250
rosa_rugosa	Rorug06G0513300
rosa_samantha	Rh7AG123600 Rh7AG123700 Rh7BG125300 Rh7BG125500 Rh7DG127200 Rh7DG127300
rosa_wichuraiana	Rw7G010570

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB1I	GGYRCC	1 cut(s)	245
AciI	CCGC	2 cut(s)	648, 1236
AclWI	GGATC	1 cut(s)	29
AcoI	YGGCCR	1 cut(s)	1176
AcsI	RAATTY	2 cut(s)	918, 1271
AcuI	CTGAAG	1 cut(s)	756
AfaI	GTAC	4 cut(s)	88, 741, 852, 1153
AfiI	CCNNNNNNNGG	5 cut(s)	242, 421, 681, 682, 724
AflIII	ACRYGT	1 cut(s)	639
AgsI	TTSAA	3 cut(s)	464, 983, 1018
AjnI	CCWGG	4 cut(s)	241, 375, 717, 932
AjuI	GAANNNNNNNTTGG	2 cut(s)	59, 91
Alw21I	GWGCWC	1 cut(s)	546
Alw26I	GTCTC	2 cut(s)	461, 942
AlwI	GGATC	1 cut(s)	29
AlwNI	CAGNNNCTG	1 cut(s)	656
AoxI	GGCC	1 cut(s)	1176
ApeKI	GCWGC	2 cut(s)	842, 1157
ApoI	RAATTY	2 cut(s)	918, 1271
ArsI	GACNNNNNNTTYG	2 cut(s)	682, 714
Asp700I	GAANNNNTTC	1 cut(s)	58
AspS9I	GGNCC	1 cut(s)	550
AsuHPI	GGTGA	2 cut(s)	598, 664
AvaII	GGWCC	1 cut(s)	550
AxyI	CCTNAGG	1 cut(s)	39
BanI	GGYRCC	1 cut(s)	245
BanII	GRGCYC	1 cut(s)	237
BbsI	GAAGAC	1 cut(s)	207
Bbv12I	GWGCWC	1 cut(s)	546
BbvI	GCAGC	2 cut(s)	854, 1169
BccI	CCATC	1 cut(s)	884
BciT130I	CCWGG	4 cut(s)	243, 377, 719, 934
BclI	TGATCA	1 cut(s)	340
BcoDI	GTCTC	2 cut(s)	461, 942
BfaI	CTAG	2 cut(s)	861, 1109
BfmI	CTRYAG	2 cut(s)	826, 1155
BglII	AGATCT	1 cut(s)	822
BisI	GCNGC	3 cut(s)	648, 843, 1158
BlsI	GCNGC	3 cut(s)	649, 844, 1159
BmcAI	AGTACT	1 cut(s)	852
Bme1390I	CCNGG	4 cut(s)	243, 377, 719, 934
Bme18I	GGWCC	1 cut(s)	550
BmgT120I	GGNCC	1 cut(s)	550
BmiI	GGNNCC	2 cut(s)	247, 552
BmrFI	CCNGG	4 cut(s)	243, 377, 719, 934
BmsI	GCATC	4 cut(s)	351, 796, 844, 1200
BpiI	GAAGAC	1 cut(s)	207
BpuEI	CTTGAG	2 cut(s)	170, 386
Bsa29I	ATCGAT	1 cut(s)	1011
BsaAI	YACGTR	1 cut(s)	301
BsaBI	GATNNNNATC	1 cut(s)	786
BsaI	GGTCTC	1 cut(s)	942
BsaJI	CCNNGG	3 cut(s)	555, 609, 933
Bsc4I	CCNNNNNNNGG	5 cut(s)	242, 421, 681, 682, 724
Bse1I	ACTGG	4 cut(s)	12, 573, 848, 1230
Bse21I	CCTNAGG	1 cut(s)	39
Bse8I	GATNNNNATC	1 cut(s)	786
BseBI	CCWGG	4 cut(s)	243, 377, 719, 934
BseCI	ATCGAT	1 cut(s)	1011
BseDI	CCNNGG	3 cut(s)	555, 609, 933
BseGI	GGATG	2 cut(s)	565, 835
BseJI	GATNNNNATC	1 cut(s)	786
BseLI	CCNNNNNNNGG	5 cut(s)	242, 421, 681, 682, 724
BseMII	CTCAG	2 cut(s)	248, 336
BseNI	ACTGG	4 cut(s)	12, 573, 848, 1230
BseXI	GCAGC	2 cut(s)	854, 1169
BsgI	GTGCAG	1 cut(s)	416
BshFI	GGCC	1 cut(s)	1178
BshNI	GGYRCC	1 cut(s)	245
BshVI	ATCGAT	1 cut(s)	1011
BsiHKAI	GWGCWC	1 cut(s)	546
BslI	CCNNNNNNNGG	5 cut(s)	242, 421, 681, 682, 724
BsmAI	GTCTC	2 cut(s)	461, 942
BsmI	GAATGC	1 cut(s)	872
BsnI	GGCC	1 cut(s)	1178
Bso31I	GGTCTC	1 cut(s)	942
Bsp1286I	GDGCHC	2 cut(s)	237, 546
Bsp143I	GATC	4 cut(s)	34, 340, 781, 822
Bsp19I	CCATGG	1 cut(s)	609
BspACI	CCGC	2 cut(s)	648, 1236
BspANI	GGCC	1 cut(s)	1178
BspCNI	CTCAG	2 cut(s)	249, 335
BspDI	ATCGAT	1 cut(s)	1011
BspLI	GGNNCC	2 cut(s)	247, 552
BspMAI	CTGCAG	1 cut(s)	1159
BspPI	GGATC	1 cut(s)	29
BspT107I	GGYRCC	1 cut(s)	245
BspTNI	GGTCTC	1 cut(s)	942
BsrI	ACTGG	4 cut(s)	12, 573, 848, 1230
BssECI	CCNNGG	3 cut(s)	555, 609, 933
BssMI	GATC	4 cut(s)	34, 340, 781, 822
BssT1I	CCWWGG	1 cut(s)	609
Bst2UI	CCWGG	4 cut(s)	243, 377, 719, 934
Bst4CI	ACNGT	1 cut(s)	86
Bst6I	CTCTTC	4 cut(s)	80, 307, 757, 1054
BstBAI	YACGTR	1 cut(s)	301
BstC8I	GCNNGC	3 cut(s)	125, 1093, 1104
BstDEI	CTNAG	5 cut(s)	31, 39, 158, 257, 322
BstDSI	CCRYGG	2 cut(s)	555, 609
BstENI	CCTNNNNNAGG	1 cut(s)	722
BstF5I	GGATG	2 cut(s)	565, 835
BstKTI	GATC	4 cut(s)	37, 343, 784, 825
BstMAI	GTCTC	2 cut(s)	461, 942
BstMBI	GATC	4 cut(s)	34, 340, 781, 822
BstMWI	GCNNNNNNNGC	3 cut(s)	215, 1092, 1154
BstNI	CCWGG	4 cut(s)	243, 377, 719, 934
BstNSI	RCATGY	2 cut(s)	601, 643
BstSCI	CCNGG	4 cut(s)	241, 375, 717, 932
BstSFI	CTRYAG	2 cut(s)	826, 1155
BstV1I	GCAGC	2 cut(s)	854, 1169
BstV2I	GAAGAC	1 cut(s)	207
BstX2I	RGATCY	2 cut(s)	34, 822
BstXI	CCANNNNNNTGG	2 cut(s)	718, 960
BstYI	RGATCY	2 cut(s)	34, 822
Bsu15I	ATCGAT	1 cut(s)	1011
Bsu36I	CCTNAGG	1 cut(s)	39
BsuRI	GGCC	1 cut(s)	1178
BsuTUI	ATCGAT	1 cut(s)	1011
BtgI	CCRYGG	2 cut(s)	555, 609
BtsCI	GGATG	2 cut(s)	565, 835
BtsIMutI	CAGTG	1 cut(s)	1237
Cac8I	GCNNGC	3 cut(s)	125, 1093, 1104
CaiI	CAGNNNCTG	1 cut(s)	656
Cfr13I	GGNCC	1 cut(s)	550
ClaI	ATCGAT	1 cut(s)	1011
Csp6I	GTAC	4 cut(s)	87, 740, 851, 1152
CviAII	CATG	8 cut(s)	50, 188, 347, 598, 610, 640, 802, 871
CviQI	GTAC	4 cut(s)	87, 740, 851, 1152
DdeI	CTNAG	5 cut(s)	31, 39, 158, 257, 322
DpnI	GATC	4 cut(s)	36, 342, 783, 824
DpnII	GATC	4 cut(s)	34, 340, 781, 822
EaeI	YGGCCR	1 cut(s)	1176
Eam1104I	CTCTTC	4 cut(s)	80, 307, 757, 1054
EarI	CTCTTC	4 cut(s)	80, 307, 757, 1054
EciI	GGCGGA	1 cut(s)	1251
Eco130I	CCWWGG	1 cut(s)	609
Eco24I	GRGCYC	1 cut(s)	237
Eco31I	GGTCTC	1 cut(s)	942
Eco47I	GGWCC	1 cut(s)	550
Eco57I	CTGAAG	1 cut(s)	756
Eco81I	CCTNAGG	1 cut(s)	39
EcoNI	CCTNNNNNAGG	1 cut(s)	722
EcoO109I	RGGNCCY	1 cut(s)	550
EcoRII	CCWGG	4 cut(s)	241, 375, 717, 932
EcoT14I	CCWWGG	1 cut(s)	609
EcoT22I	ATGCAT	1 cut(s)	872
EcoT38I	GRGCYC	1 cut(s)	237
ErhI	CCWWGG	1 cut(s)	609
FaeI	CATG	8 cut(s)	53, 191, 350, 601, 613, 643, 805, 874
FatI	CATG	8 cut(s)	49, 187, 346, 597, 609, 639, 801, 870
FbaI	TGATCA	1 cut(s)	340
Fnu4HI	GCNGC	3 cut(s)	648, 843, 1158
FokI	GGATG	2 cut(s)	572, 822
FriOI	GRGCYC	1 cut(s)	237
Fsp4HI	GCNGC	3 cut(s)	648, 843, 1158
FspBI	CTAG	2 cut(s)	861, 1109
GluI	GCNGC	3 cut(s)	648, 843, 1158
HaeIII	GGCC	1 cut(s)	1178
Hin1II	CATG	8 cut(s)	53, 191, 350, 601, 613, 643, 805, 874
HindIII	AAGCTT	1 cut(s)	1182
HinfI	GANTC	6 cut(s)	44, 54, 480, 587, 765, 956
HphI	GGTGA	2 cut(s)	598, 664
Hpy166II	GTNNAC	1 cut(s)	883
Hpy188I	TCNGA	2 cut(s)	258, 1218
Hpy188III	TCNNGA	4 cut(s)	456, 464, 475, 794
Hpy8I	GTNNAC	1 cut(s)	883
HpyAV	CCTTC	3 cut(s)	109, 426, 676
HpyCH4III	ACNGT	1 cut(s)	86
HpyCH4IV	ACGT	2 cut(s)	204, 300
HpyF10VI	GCNNNNNNNGC	3 cut(s)	215, 1092, 1154
HpyF3I	CTNAG	5 cut(s)	31, 39, 158, 257, 322
HpySE526I	ACGT	2 cut(s)	204, 300
Hsp92II	CATG	8 cut(s)	53, 191, 350, 601, 613, 643, 805, 874
Ksp22I	TGATCA	1 cut(s)	340
Kzo9I	GATC	4 cut(s)	34, 340, 781, 822
LmnI	GCTCC	2 cut(s)	541, 1138
Lsp1109I	GCAGC	2 cut(s)	854, 1169
LweI	GCATC	4 cut(s)	351, 796, 844, 1200
MaeI	CTAG	2 cut(s)	861, 1109
MaeII	ACGT	2 cut(s)	204, 300
MalI	GATC	4 cut(s)	36, 342, 783, 824
MboI	GATC	4 cut(s)	34, 340, 781, 822
MboII	GAAGA	8 cut(s)	37, 67, 212, 324, 403, 774, 887, 1071
MflI	RGATCY	2 cut(s)	34, 822
MhlI	GDGCHC	2 cut(s)	237, 546
MluCI	AATT	4 cut(s)	380, 491, 918, 1271
MlyI	GAGTC	1 cut(s)	774
MmeI	TCCRAC	1 cut(s)	1149
MnlI	CCTC	4 cut(s)	361, 612, 1055, 1232
Mph1103I	ATGCAT	1 cut(s)	872
MroXI	GAANNNNTTC	1 cut(s)	58
MseI	TTAA	1 cut(s)	440
MslI	CAYNNNNRTG	1 cut(s)	1196
MspR9I	CCNGG	4 cut(s)	243, 377, 719, 934
Mva1269I	GAATGC	1 cut(s)	872
MvaI	CCWGG	4 cut(s)	243, 377, 719, 934
MwoI	GCNNNNNNNGC	3 cut(s)	215, 1092, 1154
NcoI	CCATGG	1 cut(s)	609
NdeII	GATC	4 cut(s)	34, 340, 781, 822
NlaIII	CATG	8 cut(s)	53, 191, 350, 601, 613, 643, 805, 874
NlaIV	GGNNCC	2 cut(s)	247, 552
NsiI	ATGCAT	1 cut(s)	872
NspI	RCATGY	2 cut(s)	601, 643
PciI	ACATGT	1 cut(s)	639
PcsI	WCGNNNNNNNCGW	1 cut(s)	480
PctI	GAATGC	1 cut(s)	872
PdmI	GAANNNNTTC	1 cut(s)	58
PfeI	GAWTC	5 cut(s)	44, 54, 480, 587, 956
PfoI	TCCNGGA	1 cut(s)	717
PkrI	GCNGC	3 cut(s)	649, 844, 1159
PleI	GAGTC	1 cut(s)	773
PpsI	GAGTC	1 cut(s)	773
Ppu21I	YACGTR	1 cut(s)	301
PpuMI	RGGWCCY	1 cut(s)	550
PscI	ACATGT	1 cut(s)	639
Psp5II	RGGWCCY	1 cut(s)	550
Psp6I	CCWGG	4 cut(s)	241, 375, 717, 932
PspGI	CCWGG	4 cut(s)	241, 375, 717, 932
PspN4I	GGNNCC	2 cut(s)	247, 552
PspPI	GGNCC	1 cut(s)	550
PspPPI	RGGWCCY	1 cut(s)	550
PstI	CTGCAG	1 cut(s)	1159
PstNI	CAGNNNCTG	1 cut(s)	656
PsuI	RGATCY	2 cut(s)	34, 822
RsaI	GTAC	4 cut(s)	88, 741, 852, 1153
RsaNI	GTAC	4 cut(s)	87, 740, 851, 1152
RseI	CAYNNNNRTG	1 cut(s)	1196
SaqAI	TTAA	1 cut(s)	440
SatI	GCNGC	3 cut(s)	648, 843, 1158
Sau3AI	GATC	4 cut(s)	34, 340, 781, 822
Sau96I	GGNCC	1 cut(s)	550
ScaI	AGTACT	1 cut(s)	852
SchI	GAGTC	1 cut(s)	774
ScrFI	CCNGG	4 cut(s)	243, 377, 719, 934
SduI	GDGCHC	2 cut(s)	237, 546
SfaNI	GCATC	4 cut(s)	351, 796, 844, 1200
SfcI	CTRYAG	2 cut(s)	826, 1155
SinI	GGWCC	1 cut(s)	550
SmiMI	CAYNNNNRTG	1 cut(s)	1196
SmlI	CTYRAG	2 cut(s)	149, 365
SmoI	CTYRAG	2 cut(s)	149, 365
Sse9I	AATT	4 cut(s)	380, 491, 918, 1271
SsiI	CCGC	2 cut(s)	648, 1236
SspMI	CTAG	2 cut(s)	861, 1109
StyD4I	CCNGG	4 cut(s)	241, 375, 717, 932
StyI	CCWWGG	1 cut(s)	609
TaaI	ACNGT	1 cut(s)	86
TaiI	ACGT	2 cut(s)	207, 303
TaqI	TCGA	2 cut(s)	483, 1011
TasI	AATT	4 cut(s)	380, 491, 918, 1271
TatI	WGTACW	3 cut(s)	86, 739, 850
TauI	GCSGC	1 cut(s)	650
TfiI	GAWTC	5 cut(s)	44, 54, 480, 587, 956
Tru1I	TTAA	1 cut(s)	440
Tru9I	TTAA	1 cut(s)	440
TscAI	CASTG	1 cut(s)	1237
TseI	GCWGC	2 cut(s)	842, 1157
TspDTI	ATGAA	6 cut(s)	38, 300, 464, 658, 719, 818
TspRI	CASTG	1 cut(s)	1237
VpaK11BI	GGWCC	1 cut(s)	550
XagI	CCTNNNNNAGG	1 cut(s)	722
XapI	RAATTY	2 cut(s)	918, 1271
XceI	RCATGY	2 cut(s)	601, 643
XcmI	CCANNNNNNNNNTGG	2 cut(s)	305, 383
XmnI	GAANNNNTTC	1 cut(s)	58
XspI	CTAG	2 cut(s)	861, 1109
ZrmI	AGTACT	1 cut(s)	852
Zsp2I	ATGCAT	1 cut(s)	872

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.