Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0002242.1

Orthogroup ID

OG0005980

Physical Location & Seq

Genomic Coordinates Forward (+)

50827 .. 53228

Gene Structure 2402 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0002242.1_g000013.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 1701 bp

atggagcatgagatctgcaaaaacattcctgttataatgatgtcctctcaggattcgattaacacagtttacaaatgcatgacaagaggtgtttccgactatcttgttaagccgattaggaagaatgaactgagaaacctgtggcagcatgtttggaggagacaagctttagccagaaatatcccacaagatgagagtgttggacaagaaaagattgaaggtacatctgataatgatgctgcaagcaatcattccagtggctatgtggcatgtgctcagaggaataaggaaaacattgaaaaagggactgattctcagagctcttgtacaaagccagattttgaagctgagagtgcttctgtggaaatgcaggaattttcgcagcagatacaggctaaaaattttctggatgacttgagaatgcagaaagatgaagggaacaccaattgtagtgaaaagttgcttatgcatgaaaatgaatccagaggaccagcagtgaatgcctacaagggcaagttagcagctccactaggtgaggttgccaagccaggtagtcataggagggatgctaatatggatagtgaggcttgtgatgataacgatctccttgtcaactcttcaagaaatgtcaccgacttctttggggtatgcagtagttatccaattagcaatctcagaaactcttcatcaagtaataggcctagtacatatgattctgctccgccgttggatctttctttgagaagatcagattccagtggcattgagactcaagttactgaaaaaagtcgtactctgggccactctaacgcctcagcattttcacgatacatcaacagaccattgcagccccagaatccattgactggcataaacgatcaacaaaaggcataccaaactacatctgagaagcctgcatcccctgttaatatggattgtgatacccctgctgctacttcaagtattccaaggagtgtcatcactgtagctactggtcagtctaaccagtctgaaattggaacgtcatgccctcagcagagattatttcctcttcctgttcccgttaaaggtgtaaggtttaacaacctttgcaatgggtatggtactgtactgcctccaaccttttgcacacagtcaagtccatcaccaatgccaagttcagctgcccagcaggaaccctcatttctaatgagtacattttatccgactaatcttcaaaaccataaaccagagcatgtgtacgacccagcttatcataattccaaggttgcgatggaacagacaatgcagccgcaggaacaaagattcgatgaggatcgagggcatatctcttcaaacaatgatcagagtgcaactagtagtttttgcaatggcaatgcaagtcatctgaatagcatggggtatggaagtgcttgtggaagtaacaatgttgatcaggtggctatgttcagggctgctccagagagcaagaatgaagacagtgtctttaatcacagtggaaataatcgatccatccaaagagaagcagctctcaacaagttccggttgaagaggaaagatagatgctacgagaagaaggttcgttacgagagcagaaagaagcttgcagagcagcgtccaagaataaagggacaatttgttcgtcaagtgcttaatgatccttcacatatggaagctgatggcaatgcatatgaggattga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

ko04712 map04712

Pfam Domains

Protein Families

CCT Response_reg

Protein Analysis

566

Amino Acids

62.96

Weight (kDa)

6.52

Isoelectric Point (pI)

64.23

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0005980)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT5G24470
fragaria_vesca	FvH4_7g32920 FvH4_7g32920 FvH4_7g32920 FvH4_7g32920 FvH4_7g32920 FvH4_7g32920
malus_domestica	MD01G1228200.v1.1 MD07G1299100.v1.1
prunus_persica	Prupe.2G318900_v2.0.a1
pyrus_communis	pycom01g23650 pycom07g27150 pycom07g27160
rosa_chinensis	RchiOBHm_Chr1g0382871
rosa_laevigata	RLG00000026152
rosa_multiflora	Rmu_sc0002242.1_g000013 Rmu_sc0010366.1_g000006
rosa_roxburghii	Rroxscaffold_4G00277820
rosa_rugosa	Rorug01G0437000
rosa_samantha	Rh1AG462000 Rh1BG419000 Rh1CG432700 Rh1DG451100 Rh4BG143700 Rh4BG143800 Rh4DG139500
rosa_wichuraiana	Rw1G040980

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AanI	TTATAA	1 cut(s)	35
AccB7I	CCANNNNNTGG	1 cut(s)	866
AciI	CCGC	2 cut(s)	722, 1292
AclWI	GGATC	4 cut(s)	738, 1323, 1503, 1652
AcsI	RAATTY	2 cut(s)	374, 400
AdeI	CACNNNGTG	1 cut(s)	533
AfaI	GTAC	8 cut(s)	223, 328, 706, 793, 1105, 1110, 1195, 1241
AfiI	CCNNNNNNNGG	2 cut(s)	866, 1067
AgsI	TTSAA	8 cut(s)	218, 299, 344, 621, 960, 1217, 1335, 1549
AhlI	ACTAGT	1 cut(s)	1355
AjnI	CCWGG	1 cut(s)	547
AjuI	GAANNNNNNNTTGG	2 cut(s)	1141, 1173
AloI	GAACNNNNNNTCC	2 cut(s)	1623, 1655
Alw21I	GWGCWC	2 cut(s)	277, 323
Alw26I	GTCTC	2 cut(s)	154, 761
AlwI	GGATC	4 cut(s)	738, 1323, 1503, 1652
AoxI	GGCC	2 cut(s)	698, 799
ApoI	RAATTY	2 cut(s)	374, 400
ArsI	GACNNNNNNTTYG	2 cut(s)	1623, 1655
Asp700I	GAANNNNTTC	1 cut(s)	682
AspS9I	GGNCC	2 cut(s)	488, 799
AsuHPI	GGTGA	3 cut(s)	545, 622, 1137
AvaII	GGWCC	1 cut(s)	488
BanII	GRGCYC	1 cut(s)	323
BarI	GAAGNNNNNNTAC	2 cut(s)	1568, 1600
BbsI	GAAGAC	1 cut(s)	1482
Bbv12I	GWGCWC	2 cut(s)	277, 323
BbvCI	CCTCAGC	2 cut(s)	814, 1032
BccI	CCATC	4 cut(s)	1150, 1267, 1520, 1673
BceAI	ACGGC	1 cut(s)	709
BciT130I	CCWGG	1 cut(s)	549
BclI	TGATCA	2 cut(s)	1342, 1432
BcoDI	GTCTC	2 cut(s)	154, 761
BcuI	ACTAGT	1 cut(s)	1355
BfaI	CTAG	3 cut(s)	530, 702, 1356
BfmI	CTRYAG	1 cut(s)	984
BglII	AGATCT	1 cut(s)	12
Bme1390I	CCNGG	1 cut(s)	549
Bme18I	GGWCC	1 cut(s)	488
BmgT120I	GGNCC	2 cut(s)	488, 799
BmiI	GGNNCC	1 cut(s)	1176
BmrFI	CCNGG	1 cut(s)	549
BmsI	GCATC	4 cut(s)	226, 556, 926, 1553
BpiI	GAAGAC	1 cut(s)	1482
BpmI	CTGGAG	1 cut(s)	1443
Bpu10I	CCTNAGC	2 cut(s)	814, 1032
BpuEI	CTTGAG	2 cut(s)	436, 756
Bsa29I	ATCGAT	1 cut(s)	1507
BsaBI	GATNNNNATC	2 cut(s)	600, 1314
BsaJI	CCNNGG	2 cut(s)	968, 1263
BsaWI	WCCGGW	1 cut(s)	1542
Bsc4I	CCNNNNNNNGG	2 cut(s)	866, 1067
Bse1I	ACTGG	5 cut(s)	255, 756, 871, 997, 1006
Bse3DI	GCAATG	5 cut(s)	842, 1099, 1375, 1381, 1690
Bse8I	GATNNNNATC	2 cut(s)	600, 1314
BseBI	CCWGG	1 cut(s)	549
BseCI	ATCGAT	1 cut(s)	1507
BseDI	CCNNGG	2 cut(s)	968, 1263
BseGI	GGATG	4 cut(s)	415, 571, 917, 1512
BseJI	GATNNNNATC	2 cut(s)	600, 1314
BseLI	CCNNNNNNNGG	2 cut(s)	866, 1067
BseMI	GCAATG	5 cut(s)	842, 1099, 1375, 1381, 1690
BseMII	CTCAG	9 cut(s)	62, 122, 290, 329, 339, 688, 828, 897, 1046
BseNI	ACTGG	5 cut(s)	255, 756, 871, 997, 1006
BseRI	GAGGAG	1 cut(s)	172
BseYI	CCCAGC	2 cut(s)	1167, 1246
BshFI	GGCC	2 cut(s)	700, 801
BshVI	ATCGAT	1 cut(s)	1507
BsiHKAI	GWGCWC	2 cut(s)	277, 323
BsiSI	CCGG	1 cut(s)	1543
BslFI	GGGAC	2 cut(s)	319, 1644
BslI	CCNNNNNNNGG	2 cut(s)	866, 1067
BsmAI	GTCTC	2 cut(s)	154, 761
BsmFI	GGGAC	2 cut(s)	319, 1644
BsmI	GAATGC	2 cut(s)	426, 505
BsnI	GGCC	2 cut(s)	700, 801
Bsp1286I	GDGCHC	2 cut(s)	277, 323
Bsp1407I	TGTACA	1 cut(s)	326
BspACI	CCGC	2 cut(s)	722, 1292
BspANI	GGCC	2 cut(s)	700, 801
BspCNI	CTCAG	9 cut(s)	61, 123, 289, 328, 340, 687, 827, 898, 1045
BspDI	ATCGAT	1 cut(s)	1507
BspLI	GGNNCC	1 cut(s)	1176
BspPI	GGATC	4 cut(s)	738, 1323, 1503, 1652
BsrDI	GCAATG	5 cut(s)	842, 1099, 1375, 1381, 1690
BsrGI	TGTACA	1 cut(s)	326
BsrI	ACTGG	5 cut(s)	255, 756, 871, 997, 1006
BssECI	CCNNGG	2 cut(s)	968, 1263
BssT1I	CCWWGG	2 cut(s)	968, 1263
Bst2UI	CCWGG	1 cut(s)	549
Bst4CI	ACNGT	6 cut(s)	67, 985, 1108, 1134, 1481, 1496
Bst6I	CTCTTC	5 cut(s)	622, 688, 1056, 1336, 1544
BstAPI	GCANNNNNTGC	1 cut(s)	500
BstAUI	TGTACA	1 cut(s)	326
BstC8I	GCNNGC	3 cut(s)	244, 915, 1605
BstDEI	CTNAG	9 cut(s)	48, 131, 276, 315, 348, 674, 814, 906, 1032
BstF5I	GGATG	4 cut(s)	415, 571, 917, 1512
BstMAI	GTCTC	2 cut(s)	154, 761
BstMWI	GCNNNNNNNGC	3 cut(s)	353, 500, 1609
BstNI	CCWGG	1 cut(s)	549
BstNSI	RCATGY	3 cut(s)	152, 273, 1238
BstSCI	CCNGG	1 cut(s)	547
BstSFI	CTRYAG	1 cut(s)	984
BstV2I	GAAGAC	1 cut(s)	1482
BstX2I	RGATCY	2 cut(s)	12, 730
BstYI	RGATCY	2 cut(s)	12, 730
Bsu15I	ATCGAT	1 cut(s)	1507
BsuRI	GGCC	2 cut(s)	700, 801
BsuTUI	ATCGAT	1 cut(s)	1507
BtgZI	GCGATG	1 cut(s)	1286
BtsCI	GGATG	4 cut(s)	415, 571, 917, 1512
BtsI	GCAGTG	1 cut(s)	501
BtsIMutI	CAGTG	6 cut(s)	262, 501, 763, 981, 1486, 1501
Cac8I	GCNNGC	3 cut(s)	244, 915, 1605
Cfr13I	GGNCC	2 cut(s)	488, 799
ClaI	ATCGAT	1 cut(s)	1507
CseI	GACGC	1 cut(s)	1604
Csp6I	GTAC	8 cut(s)	222, 327, 705, 792, 1104, 1109, 1194, 1240
CviAII	CATG	8 cut(s)	8, 79, 149, 270, 470, 1026, 1235, 1396
CviQI	GTAC	8 cut(s)	222, 327, 705, 792, 1104, 1109, 1194, 1240
DdeI	CTNAG	9 cut(s)	48, 131, 276, 315, 348, 674, 814, 906, 1032
DraIII	CACNNNGTG	1 cut(s)	533
Eam1104I	CTCTTC	5 cut(s)	622, 688, 1056, 1336, 1544
EarI	CTCTTC	5 cut(s)	622, 688, 1056, 1336, 1544
EciI	GGCGGA	1 cut(s)	711
Ecl136II	GAGCTC	1 cut(s)	321
Eco130I	CCWWGG	2 cut(s)	968, 1263
Eco147I	AGGCCT	1 cut(s)	700
Eco24I	GRGCYC	1 cut(s)	323
Eco47I	GGWCC	1 cut(s)	488
Eco53kI	GAGCTC	1 cut(s)	321
EcoICRI	GAGCTC	1 cut(s)	321
EcoRII	CCWGG	1 cut(s)	547
EcoT14I	CCWWGG	2 cut(s)	968, 1263
EcoT22I	ATGCAT	3 cut(s)	80, 471, 1690
EcoT38I	GRGCYC	1 cut(s)	323
ErhI	CCWWGG	2 cut(s)	968, 1263
FaeI	CATG	8 cut(s)	11, 82, 152, 273, 473, 1029, 1238, 1399
FaqI	GGGAC	2 cut(s)	319, 1644
FatI	CATG	8 cut(s)	7, 78, 148, 269, 469, 1025, 1234, 1395
FauNDI	CATATG	3 cut(s)	709, 1668, 1690
FbaI	TGATCA	2 cut(s)	1342, 1432
FokI	GGATG	4 cut(s)	422, 578, 904, 1499
FriOI	GRGCYC	1 cut(s)	323
FspBI	CTAG	3 cut(s)	530, 702, 1356
GsaI	CCCAGC	2 cut(s)	1171, 1250
GsuI	CTGGAG	1 cut(s)	1443
HaeIII	GGCC	2 cut(s)	700, 801
HapII	CCGG	1 cut(s)	1543
HgaI	GACGC	1 cut(s)	1604
Hin1II	CATG	8 cut(s)	11, 82, 152, 273, 473, 1029, 1238, 1399
HincII	GTYRAC	1 cut(s)	613
HindII	GTYRAC	1 cut(s)	613
HindIII	AAGCTT	2 cut(s)	165, 1601
HinfI	GANTC	8 cut(s)	53, 311, 479, 713, 752, 769, 856, 1305
HpaII	CCGG	1 cut(s)	1543
HphI	GGTGA	3 cut(s)	545, 622, 1137
Hpy166II	GTNNAC	3 cut(s)	70, 613, 1240
Hpy188III	TCNNGA	6 cut(s)	50, 407, 483, 621, 825, 1460
Hpy8I	GTNNAC	3 cut(s)	70, 613, 1240
HpyAV	CCTTC	4 cut(s)	212, 428, 1570, 1671
HpyCH4III	ACNGT	6 cut(s)	67, 985, 1108, 1134, 1481, 1496
HpyCH4IV	ACGT	1 cut(s)	1022
HpyF10VI	GCNNNNNNNGC	3 cut(s)	353, 500, 1609
HpyF3I	CTNAG	9 cut(s)	48, 131, 276, 315, 348, 674, 814, 906, 1032
HpySE526I	ACGT	1 cut(s)	1022
Hsp92II	CATG	8 cut(s)	11, 82, 152, 273, 473, 1029, 1238, 1399
Ksp22I	TGATCA	2 cut(s)	1342, 1432
LmnI	GCTCC	4 cut(s)	4, 529, 724, 1462
LweI	GCATC	4 cut(s)	226, 556, 926, 1553
MaeI	CTAG	3 cut(s)	530, 702, 1356
MaeII	ACGT	1 cut(s)	1022
MaeIII	GTNAC	4 cut(s)	628, 775, 1421, 1583
MfeI	CAATTG	1 cut(s)	445
MflI	RGATCY	2 cut(s)	12, 730
MhlI	GDGCHC	2 cut(s)	277, 323
MluCI	AATT	7 cut(s)	374, 400, 445, 663, 1014, 1258, 1634
MlyI	GAGTC	1 cut(s)	763
MmeI	TCCRAC	5 cut(s)	120, 181, 708, 1142, 1229
Mph1103I	ATGCAT	3 cut(s)	80, 471, 1690
MroXI	GAANNNNTTC	1 cut(s)	682
MseI	TTAA	7 cut(s)	60, 108, 927, 1065, 1080, 1488, 1653
MslI	CAYNNNNRTG	2 cut(s)	255, 474
MspA1I	CMGCKG	1 cut(s)	1163
MspI	CCGG	1 cut(s)	1543
MspR9I	CCNGG	1 cut(s)	549
MunI	CAATTG	1 cut(s)	445
Mva1269I	GAATGC	2 cut(s)	426, 505
MvaI	CCWGG	1 cut(s)	549
MwoI	GCNNNNNNNGC	3 cut(s)	353, 500, 1609
NdeI	CATATG	3 cut(s)	709, 1668, 1690
NlaIII	CATG	8 cut(s)	11, 82, 152, 273, 473, 1029, 1238, 1399
NlaIV	GGNNCC	1 cut(s)	1176
NmuCI	GTSAC	1 cut(s)	628
NsiI	ATGCAT	3 cut(s)	80, 471, 1690
NspI	RCATGY	3 cut(s)	152, 273, 1238
PceI	AGGCCT	1 cut(s)	700
PctI	GAATGC	2 cut(s)	426, 505
PdmI	GAANNNNTTC	1 cut(s)	682
PfeI	GAWTC	7 cut(s)	53, 311, 479, 713, 752, 856, 1305
PflFI	GACNNNGTC	1 cut(s)	1481
PflMI	CCANNNNNTGG	1 cut(s)	866
PleI	GAGTC	1 cut(s)	763
PpsI	GAGTC	1 cut(s)	763
PsiI	TTATAA	1 cut(s)	35
Psp124BI	GAGCTC	1 cut(s)	323
Psp6I	CCWGG	1 cut(s)	547
PspFI	CCCAGC	2 cut(s)	1167, 1246
PspGI	CCWGG	1 cut(s)	547
PspN4I	GGNNCC	1 cut(s)	1176
PspPI	GGNCC	2 cut(s)	488, 799
PsuI	RGATCY	2 cut(s)	12, 730
PsyI	GACNNNGTC	1 cut(s)	1481
PvuII	CAGCTG	1 cut(s)	1163
RsaI	GTAC	8 cut(s)	223, 328, 706, 793, 1105, 1110, 1195, 1241
RsaNI	GTAC	8 cut(s)	222, 327, 705, 792, 1104, 1109, 1194, 1240
RseI	CAYNNNNRTG	2 cut(s)	255, 474
SacI	GAGCTC	1 cut(s)	323
SaqAI	TTAA	7 cut(s)	60, 108, 927, 1065, 1080, 1488, 1653
Sau96I	GGNCC	2 cut(s)	488, 799
SchI	GAGTC	1 cut(s)	763
ScrFI	CCNGG	1 cut(s)	549
SduI	GDGCHC	2 cut(s)	277, 323
SfaNI	GCATC	4 cut(s)	226, 556, 926, 1553
SfcI	CTRYAG	1 cut(s)	984
SinI	GGWCC	1 cut(s)	488
SmiMI	CAYNNNNRTG	2 cut(s)	255, 474
SmlI	CTYRAG	2 cut(s)	415, 771
SmoI	CTYRAG	2 cut(s)	415, 771
SpeI	ACTAGT	1 cut(s)	1355
Sse9I	AATT	7 cut(s)	374, 400, 445, 663, 1014, 1258, 1634
SseBI	AGGCCT	1 cut(s)	700
SsiI	CCGC	2 cut(s)	722, 1292
SspMI	CTAG	3 cut(s)	530, 702, 1356
SstI	GAGCTC	1 cut(s)	323
StuI	AGGCCT	1 cut(s)	700
StyD4I	CCNGG	1 cut(s)	547
StyI	CCWWGG	2 cut(s)	968, 1263
TaaI	ACNGT	6 cut(s)	67, 985, 1108, 1134, 1481, 1496
TaiI	ACGT	1 cut(s)	1025
TaqI	TCGA	4 cut(s)	56, 1308, 1318, 1507
TasI	AATT	7 cut(s)	374, 400, 445, 663, 1014, 1258, 1634
TatI	WGTACW	4 cut(s)	326, 704, 1108, 1193
TauI	GCSGC	1 cut(s)	1294
TfiI	GAWTC	7 cut(s)	53, 311, 479, 713, 752, 856, 1305
Tru1I	TTAA	7 cut(s)	60, 108, 927, 1065, 1080, 1488, 1653
Tru9I	TTAA	7 cut(s)	60, 108, 927, 1065, 1080, 1488, 1653
TscAI	CASTG	6 cut(s)	262, 501, 763, 988, 1486, 1501
TseFI	GTSAC	1 cut(s)	628
Tsp45I	GTSAC	1 cut(s)	628
TspDTI	ATGAA	6 cut(s)	141, 447, 486, 492, 675, 1488
TspRI	CASTG	6 cut(s)	262, 501, 763, 988, 1486, 1501
Tth111I	GACNNNGTC	1 cut(s)	1481
Van91I	CCANNNNNTGG	1 cut(s)	866
VpaK11BI	GGWCC	1 cut(s)	488
XapI	RAATTY	2 cut(s)	374, 400
XceI	RCATGY	3 cut(s)	152, 273, 1238
XcmI	CCANNNNNNNNNTGG	3 cut(s)	262, 1013, 1270
XmnI	GAANNNNTTC	1 cut(s)	682
XspI	CTAG	3 cut(s)	530, 702, 1356
Zsp2I	ATGCAT	3 cut(s)	80, 471, 1690

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.