Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0010366.1

Orthogroup ID

OG0005980

Physical Location & Seq

Genomic Coordinates Reverse (-)

30231 .. 33917

Gene Structure 3687 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0010366.1_g000006.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 2052 bp

atgggtgaggttgtggtgagtagtgaggaaatgagaacagagagtgagaagcagagaagtacagagatgaagaacaatggcggaggtggcggtgactcatcaagtggggttgtgatgaggtgggagaagctcttgcctggaatgaacatgagggtcttgttggttgaggctgatgactccacaaggcatattatagctgctttgctcaggaaatgtagctatagagttgctgctgtacctgatggcttaaaggcatgggaaatactgaaggcaaggtctgataagatagacctcatactgatggaagtagatctgccatcaatatctggatttgctctgcttacactaatcatggagcatgagatctgcaaaaacattcctgttataatgatgtcctctcaggattcgattaacacagtttacaaatgcatgacaagaggtgtttccgactatcttgttaagccgattaggaagaatgaactgagaaacctgtggcagcatgtttggaggagacaagctttagccagaaatatcccacaagatgagagtgttggacaagaaaagattgaaggtacatctgataatgatgctgcaagcaatcattccagtggctatgtggcatgtgctcagaggaataaggaaaacattgaaaaagggactgattctcagagctcttgtacaaagccagattttgaagctgagagtgcttctgtggaaatgcaggaattttcgcagcagatacaggctaaaaattttctggatgacttgagaatgcagaaagatgaagggaacaccaattgtagtgaaaagttgcttatgcatgaaaatgaatccagaggaccagcagtgaatgcctacaagggcaagttagcagctccactaggtgaggttgccaagccaggtagtcataggagggatgctaatatggatagtgaggcttgtgatgataacgatctccttgtcaactcttcaagaaatgtcaccgacttctttggggtatgcagtagttatccaattagcaatctcagaaactcttcatcaagtaataggcctagtacatatgattctgctccgccgttggatctttctttgagaagatcagattccagtggcattgagactcaagttactgaaaaaagtcgtactctgggccactctaacgcctcagcattttcacgatacatcaacagaccattgcagccccagaatccattgactggcataaacgatcaacaaaaggcataccaaactacatctgagaagcctgcatcccctgttaatatggattgtgatacccctgctgctacttcaagtattccaaggagtgtcatcactgtagctactggtcagtctaaccagtctgaaattggaacgtcatgccctcagcagagattatttcctcttcctgttcccgttaaaggtgtaaggtttaacaacctttgcaatgggtatggtactgtactgcctccaaccttttgcacacagtcaagtccatcaccaatgccaagttcagctgcccagcaggaatcctcatttctaatgagtacattttatccgactaatcttcaaaaccataaaccagagcatgtgtacgacccagcttatcataattccaaggttgcgatggaacagacaatgcagccgcaggaacaaagattcgatgaggatcgagggcatatctcttcaaacaatgatcagagtgcaactagtagtttttgcaatggcaatgcaagtcatctgaatagcatggggtatggaagtgcttgtggaagtaacaatgttgatcaggtggctatgttcagggctgctccagagagcaagaatgaagacagtgtctttaatcacagtggaaataatcgatccatccaaagagaagcagctctcaacaagttccggttgaagaggaaagatagatgctacgagaagaaggttcgttacgagagcagaaagaagcttgcagagcagcgtccaagaataaagggacaatttgttcgtcaagtgcttaatgatccttcacatatggaagctgatggcaatgcatatgaggattga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

ko04712 map04712

Pfam Domains

Protein Families

CCT Response_reg

Protein Analysis

683

Amino Acids

75.75

Weight (kDa)

6.32

Isoelectric Point (pI)

62.63

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0005980)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT5G24470
fragaria_vesca	FvH4_7g32920 FvH4_7g32920 FvH4_7g32920 FvH4_7g32920 FvH4_7g32920 FvH4_7g32920
malus_domestica	MD01G1228200.v1.1 MD07G1299100.v1.1
prunus_persica	Prupe.2G318900_v2.0.a1
pyrus_communis	pycom01g23650 pycom07g27150 pycom07g27160
rosa_chinensis	RchiOBHm_Chr1g0382871
rosa_laevigata	RLG00000026152
rosa_multiflora	Rmu_sc0002242.1_g000013 Rmu_sc0010366.1_g000006
rosa_roxburghii	Rroxscaffold_4G00277820
rosa_rugosa	Rorug01G0437000
rosa_samantha	Rh1AG462000 Rh1BG419000 Rh1CG432700 Rh1DG451100 Rh4BG143700 Rh4BG143800 Rh4DG139500
rosa_wichuraiana	Rw1G040980

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AanI	TTATAA	1 cut(s)	386
AccB7I	CCANNNNNTGG	1 cut(s)	1217
AciI	CCGC	4 cut(s)	81, 90, 1073, 1643
AclWI	GGATC	4 cut(s)	1089, 1674, 1854, 2003
AcsI	RAATTY	2 cut(s)	725, 751
AcuI	CTGAAG	1 cut(s)	287
AdeI	CACNNNGTG	1 cut(s)	884
AfiI	CCNNNNNNNGG	2 cut(s)	1217, 1418
AgsI	TTSAA	8 cut(s)	569, 650, 695, 972, 1311, 1568, 1686, 1900
AhlI	ACTAGT	1 cut(s)	1706
AjnI	CCWGG	2 cut(s)	136, 898
AjuI	GAANNNNNNNTTGG	2 cut(s)	1492, 1524
AloI	GAACNNNNNNTCC	2 cut(s)	1974, 2006
Alw21I	GWGCWC	2 cut(s)	628, 674
Alw26I	GTCTC	2 cut(s)	505, 1112
AlwI	GGATC	4 cut(s)	1089, 1674, 1854, 2003
AoxI	GGCC	2 cut(s)	1049, 1150
ApoI	RAATTY	2 cut(s)	725, 751
ArsI	GACNNNNNNTTYG	2 cut(s)	1974, 2006
Asp700I	GAANNNNTTC	1 cut(s)	1033
AspS9I	GGNCC	2 cut(s)	839, 1150
AsuHPI	GGTGA	6 cut(s)	17, 28, 104, 896, 973, 1488
AvaII	GGWCC	1 cut(s)	839
BanII	GRGCYC	1 cut(s)	674
BarI	GAAGNNNNNNTAC	2 cut(s)	1919, 1951
BbsI	GAAGAC	1 cut(s)	1833
Bbv12I	GWGCWC	2 cut(s)	628, 674
BbvCI	CCTCAGC	2 cut(s)	1165, 1383
BccI	CCATC	7 cut(s)	236, 295, 325, 1501, 1618, 1871, 2024
BceAI	ACGGC	1 cut(s)	1060
BciT130I	CCWGG	2 cut(s)	138, 900
BclI	TGATCA	2 cut(s)	1693, 1783
BcoDI	GTCTC	2 cut(s)	505, 1112
BcuI	ACTAGT	1 cut(s)	1706
BfaI	CTAG	3 cut(s)	881, 1053, 1707
BfmI	CTRYAG	2 cut(s)	220, 1335
BglII	AGATCT	2 cut(s)	310, 363
Bme1390I	CCNGG	2 cut(s)	138, 900
Bme18I	GGWCC	1 cut(s)	839
BmgT120I	GGNCC	2 cut(s)	839, 1150
BmrFI	CCNGG	2 cut(s)	138, 900
BmsI	GCATC	4 cut(s)	577, 907, 1277, 1904
BpiI	GAAGAC	1 cut(s)	1833
BpmI	CTGGAG	1 cut(s)	1794
Bpu10I	CCTNAGC	3 cut(s)	206, 1165, 1383
BpuEI	CTTGAG	2 cut(s)	787, 1107
Bsa29I	ATCGAT	1 cut(s)	1858
BsaBI	GATNNNNATC	2 cut(s)	951, 1665
BsaJI	CCNNGG	2 cut(s)	1319, 1614
BsaWI	WCCGGW	1 cut(s)	1893
Bsc4I	CCNNNNNNNGG	2 cut(s)	1217, 1418
Bse1I	ACTGG	5 cut(s)	606, 1107, 1222, 1348, 1357
Bse3DI	GCAATG	5 cut(s)	1193, 1450, 1726, 1732, 2041
Bse8I	GATNNNNATC	2 cut(s)	951, 1665
BseBI	CCWGG	2 cut(s)	138, 900
BseCI	ATCGAT	1 cut(s)	1858
BseDI	CCNNGG	2 cut(s)	1319, 1614
BseGI	GGATG	4 cut(s)	766, 922, 1268, 1863
BseJI	GATNNNNATC	2 cut(s)	951, 1665
BseLI	CCNNNNNNNGG	2 cut(s)	1217, 1418
BseMI	GCAATG	5 cut(s)	1193, 1450, 1726, 1732, 2041
BseNI	ACTGG	5 cut(s)	606, 1107, 1222, 1348, 1357
BseRI	GAGGAG	1 cut(s)	523
BseYI	CCCAGC	2 cut(s)	1518, 1597
BshFI	GGCC	2 cut(s)	1051, 1152
BshVI	ATCGAT	1 cut(s)	1858
BsiHKAI	GWGCWC	2 cut(s)	628, 674
BsiSI	CCGG	1 cut(s)	1894
BslFI	GGGAC	2 cut(s)	670, 1995
BslI	CCNNNNNNNGG	2 cut(s)	1217, 1418
BsmAI	GTCTC	2 cut(s)	505, 1112
BsmFI	GGGAC	2 cut(s)	670, 1995
BsmI	GAATGC	2 cut(s)	777, 856
BsnI	GGCC	2 cut(s)	1051, 1152
Bsp1286I	GDGCHC	2 cut(s)	628, 674
Bsp1407I	TGTACA	1 cut(s)	677
BspACI	CCGC	4 cut(s)	81, 90, 1073, 1643
BspANI	GGCC	2 cut(s)	1051, 1152
BspDI	ATCGAT	1 cut(s)	1858
BspPI	GGATC	4 cut(s)	1089, 1674, 1854, 2003
BsrDI	GCAATG	5 cut(s)	1193, 1450, 1726, 1732, 2041
BsrGI	TGTACA	1 cut(s)	677
BsrI	ACTGG	5 cut(s)	606, 1107, 1222, 1348, 1357
BssECI	CCNNGG	2 cut(s)	1319, 1614
BssT1I	CCWWGG	2 cut(s)	1319, 1614
Bst2UI	CCWGG	2 cut(s)	138, 900
Bst4CI	ACNGT	6 cut(s)	418, 1336, 1459, 1485, 1832, 1847
Bst6I	CTCTTC	5 cut(s)	973, 1039, 1407, 1687, 1895
BstAPI	GCANNNNNTGC	1 cut(s)	851
BstAUI	TGTACA	1 cut(s)	677
BstC8I	GCNNGC	3 cut(s)	595, 1266, 1956
BstF5I	GGATG	4 cut(s)	766, 922, 1268, 1863
BstMAI	GTCTC	2 cut(s)	505, 1112
BstMWI	GCNNNNNNNGC	4 cut(s)	87, 704, 851, 1960
BstNI	CCWGG	2 cut(s)	138, 900
BstNSI	RCATGY	3 cut(s)	503, 624, 1589
BstSCI	CCNGG	2 cut(s)	136, 898
BstSFI	CTRYAG	2 cut(s)	220, 1335
BstV2I	GAAGAC	1 cut(s)	1833
BstX2I	RGATCY	3 cut(s)	310, 363, 1081
BstYI	RGATCY	3 cut(s)	310, 363, 1081
Bsu15I	ATCGAT	1 cut(s)	1858
BsuRI	GGCC	2 cut(s)	1051, 1152
BsuTUI	ATCGAT	1 cut(s)	1858
BtgZI	GCGATG	1 cut(s)	1637
BtsCI	GGATG	4 cut(s)	766, 922, 1268, 1863
BtsI	GCAGTG	1 cut(s)	852
BtsIMutI	CAGTG	6 cut(s)	613, 852, 1114, 1332, 1837, 1852
Cac8I	GCNNGC	3 cut(s)	595, 1266, 1956
Cfr13I	GGNCC	2 cut(s)	839, 1150
ClaI	ATCGAT	1 cut(s)	1858
CseI	GACGC	1 cut(s)	1955
DraIII	CACNNNGTG	1 cut(s)	884
Eam1104I	CTCTTC	5 cut(s)	973, 1039, 1407, 1687, 1895
EarI	CTCTTC	5 cut(s)	973, 1039, 1407, 1687, 1895
EciI	GGCGGA	2 cut(s)	96, 1062
Ecl136II	GAGCTC	1 cut(s)	672
Eco130I	CCWWGG	2 cut(s)	1319, 1614
Eco147I	AGGCCT	1 cut(s)	1051
Eco24I	GRGCYC	1 cut(s)	674
Eco47I	GGWCC	1 cut(s)	839
Eco53kI	GAGCTC	1 cut(s)	672
Eco57I	CTGAAG	1 cut(s)	287
EcoICRI	GAGCTC	1 cut(s)	672
EcoRII	CCWGG	2 cut(s)	136, 898
EcoT14I	CCWWGG	2 cut(s)	1319, 1614
EcoT22I	ATGCAT	3 cut(s)	431, 822, 2041
EcoT38I	GRGCYC	1 cut(s)	674
ErhI	CCWWGG	2 cut(s)	1319, 1614
FaqI	GGGAC	2 cut(s)	670, 1995
FauNDI	CATATG	3 cut(s)	1060, 2019, 2041
FbaI	TGATCA	2 cut(s)	1693, 1783
FokI	GGATG	4 cut(s)	773, 929, 1255, 1850
FriOI	GRGCYC	1 cut(s)	674
FspBI	CTAG	3 cut(s)	881, 1053, 1707
GsaI	CCCAGC	2 cut(s)	1522, 1601
GsuI	CTGGAG	1 cut(s)	1794
HaeIII	GGCC	2 cut(s)	1051, 1152
HapII	CCGG	1 cut(s)	1894
HgaI	GACGC	1 cut(s)	1955
HincII	GTYRAC	1 cut(s)	964
HindII	GTYRAC	1 cut(s)	964
HindIII	AAGCTT	2 cut(s)	516, 1952
HpaII	CCGG	1 cut(s)	1894
HphI	GGTGA	6 cut(s)	17, 28, 104, 896, 973, 1488
Hpy166II	GTNNAC	3 cut(s)	421, 964, 1591
Hpy188III	TCNNGA	8 cut(s)	208, 327, 401, 758, 834, 972, 1176, 1811
Hpy8I	GTNNAC	3 cut(s)	421, 964, 1591
HpyAV	CCTTC	5 cut(s)	262, 563, 779, 1921, 2022
HpyCH4III	ACNGT	6 cut(s)	418, 1336, 1459, 1485, 1832, 1847
HpyCH4IV	ACGT	1 cut(s)	1373
HpyF10VI	GCNNNNNNNGC	4 cut(s)	87, 704, 851, 1960
HpySE526I	ACGT	1 cut(s)	1373
Ksp22I	TGATCA	2 cut(s)	1693, 1783
LmnI	GCTCC	4 cut(s)	355, 880, 1075, 1813
LweI	GCATC	4 cut(s)	577, 907, 1277, 1904
MaeI	CTAG	3 cut(s)	881, 1053, 1707
MaeII	ACGT	1 cut(s)	1373
MaeIII	GTNAC	5 cut(s)	92, 979, 1126, 1772, 1934
MfeI	CAATTG	1 cut(s)	796
MflI	RGATCY	3 cut(s)	310, 363, 1081
MhlI	GDGCHC	2 cut(s)	628, 674
MluCI	AATT	7 cut(s)	725, 751, 796, 1014, 1365, 1609, 1985
MlyI	GAGTC	3 cut(s)	89, 170, 1114
MmeI	TCCRAC	5 cut(s)	471, 532, 1059, 1493, 1580
Mph1103I	ATGCAT	3 cut(s)	431, 822, 2041
MroXI	GAANNNNTTC	1 cut(s)	1033
MseI	TTAA	8 cut(s)	248, 411, 459, 1278, 1416, 1431, 1839, 2004
MslI	CAYNNNNRTG	3 cut(s)	299, 606, 825
MspA1I	CMGCKG	1 cut(s)	1514
MspI	CCGG	1 cut(s)	1894
MspR9I	CCNGG	2 cut(s)	138, 900
MunI	CAATTG	1 cut(s)	796
Mva1269I	GAATGC	2 cut(s)	777, 856
MvaI	CCWGG	2 cut(s)	138, 900
MwoI	GCNNNNNNNGC	4 cut(s)	87, 704, 851, 1960
NdeI	CATATG	3 cut(s)	1060, 2019, 2041
NmuCI	GTSAC	2 cut(s)	92, 979
NsiI	ATGCAT	3 cut(s)	431, 822, 2041
NspI	RCATGY	3 cut(s)	503, 624, 1589
PceI	AGGCCT	1 cut(s)	1051
PctI	GAATGC	2 cut(s)	777, 856
PdmI	GAANNNNTTC	1 cut(s)	1033
PfeI	GAWTC	8 cut(s)	404, 662, 830, 1064, 1103, 1207, 1526, 1656
PflFI	GACNNNGTC	1 cut(s)	1832
PflMI	CCANNNNNTGG	1 cut(s)	1217
PleI	GAGTC	3 cut(s)	89, 170, 1114
PpsI	GAGTC	3 cut(s)	89, 170, 1114
PsiI	TTATAA	1 cut(s)	386
Psp124BI	GAGCTC	1 cut(s)	674
Psp6I	CCWGG	2 cut(s)	136, 898
PspFI	CCCAGC	2 cut(s)	1518, 1597
PspGI	CCWGG	2 cut(s)	136, 898
PspPI	GGNCC	2 cut(s)	839, 1150
PsuI	RGATCY	3 cut(s)	310, 363, 1081
PsyI	GACNNNGTC	1 cut(s)	1832
PvuII	CAGCTG	1 cut(s)	1514
RseI	CAYNNNNRTG	3 cut(s)	299, 606, 825
SacI	GAGCTC	1 cut(s)	674
SaqAI	TTAA	8 cut(s)	248, 411, 459, 1278, 1416, 1431, 1839, 2004
Sau96I	GGNCC	2 cut(s)	839, 1150
SchI	GAGTC	3 cut(s)	89, 170, 1114
ScrFI	CCNGG	2 cut(s)	138, 900
SduI	GDGCHC	2 cut(s)	628, 674
SfaNI	GCATC	4 cut(s)	577, 907, 1277, 1904
SfcI	CTRYAG	2 cut(s)	220, 1335
SinI	GGWCC	1 cut(s)	839
SmiMI	CAYNNNNRTG	3 cut(s)	299, 606, 825
SmlI	CTYRAG	2 cut(s)	766, 1122
SmoI	CTYRAG	2 cut(s)	766, 1122
SpeI	ACTAGT	1 cut(s)	1706
Sse9I	AATT	7 cut(s)	725, 751, 796, 1014, 1365, 1609, 1985
SseBI	AGGCCT	1 cut(s)	1051
SsiI	CCGC	4 cut(s)	81, 90, 1073, 1643
SspMI	CTAG	3 cut(s)	881, 1053, 1707
SstI	GAGCTC	1 cut(s)	674
StuI	AGGCCT	1 cut(s)	1051
StyD4I	CCNGG	2 cut(s)	136, 898
StyI	CCWWGG	2 cut(s)	1319, 1614
TaaI	ACNGT	6 cut(s)	418, 1336, 1459, 1485, 1832, 1847
TaiI	ACGT	1 cut(s)	1376
TaqI	TCGA	4 cut(s)	407, 1659, 1669, 1858
TasI	AATT	7 cut(s)	725, 751, 796, 1014, 1365, 1609, 1985
TatI	WGTACW	5 cut(s)	59, 677, 1055, 1459, 1544
TauI	GCSGC	1 cut(s)	1645
TfiI	GAWTC	8 cut(s)	404, 662, 830, 1064, 1103, 1207, 1526, 1656
Tru1I	TTAA	8 cut(s)	248, 411, 459, 1278, 1416, 1431, 1839, 2004
Tru9I	TTAA	8 cut(s)	248, 411, 459, 1278, 1416, 1431, 1839, 2004
TscAI	CASTG	6 cut(s)	613, 852, 1114, 1339, 1837, 1852
TseFI	GTSAC	2 cut(s)	92, 979
Tsp45I	GTSAC	2 cut(s)	92, 979
TspDTI	ATGAA	8 cut(s)	83, 158, 492, 798, 837, 843, 1026, 1839
TspRI	CASTG	6 cut(s)	613, 852, 1114, 1339, 1837, 1852
Tth111I	GACNNNGTC	1 cut(s)	1832
Van91I	CCANNNNNTGG	1 cut(s)	1217
VpaK11BI	GGWCC	1 cut(s)	839
XapI	RAATTY	2 cut(s)	725, 751
XceI	RCATGY	3 cut(s)	503, 624, 1589
XcmI	CCANNNNNNNNNTGG	3 cut(s)	613, 1364, 1621
XmnI	GAANNNNTTC	1 cut(s)	1033
XspI	CTAG	3 cut(s)	881, 1053, 1707
Zsp2I	ATGCAT	3 cut(s)	431, 822, 2041

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.