Rmu_sc0002277.1_g000015

No description available

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0002277.1
Physical Location & Seq
Reverse (-)
63358 .. 64131
774 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0002277.1_g000015.1.cds

Sequence Viewer

Length: 456 bp
atggagcttatggatgagattcagaagaaggatggcgtggaggatggtggtggtggtggagaagtcagattctgttgtggtggtggaagtagctatttccaacatcttaccaaagaagtgatgaaacaagaaacggaagtagctaccagattggttgctcgtaaggaggaatgcgagagaatgttgaaggatgttaaggagaagttggaaaaggatgaaacaagtgaaatggcagagacttcattttgggatgactgggagcgtgatggtggtggaggtgagtcgcggtggtgcttagagaagtgtggtggaggagcgactcgagctctcatagagaaacccagaagcaaaaatggattgatttcattaggaagggtggcaatgcccattttgcccttcttgtggattgaaaaactgaaaagtgggtctgcctgtcggtgccacatcaccatttga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

151

Amino Acids

16.86

Weight (kDa)

5.39

Isoelectric Point (pI)

60.67

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 438
AccII CGCG 1 cut(s) 286
AciI CCGC 1 cut(s) 286
AfiI CCNNNNNNNGG 1 cut(s) 402
AgsI TTSAA 2 cut(s) 187, 410
AluBI AGCT 4 cut(s) 7, 93, 143, 326
AluI AGCT 4 cut(s) 7, 93, 143, 326
Alw21I GWGCWC 1 cut(s) 328
Alw26I GTCTC 1 cut(s) 230
AlwNI CAGNNNCTG 1 cut(s) 72
Ama87I CYCGRG 1 cut(s) 321
AsuHPI GGTGA 2 cut(s) 290, 439
AvaI CYCGRG 1 cut(s) 321
BanI GGYRCC 1 cut(s) 438
BanII GRGCYC 1 cut(s) 328
Bbv12I GWGCWC 1 cut(s) 328
BccI CCATC 3 cut(s) 26, 38, 260
BcoDI GTCTC 1 cut(s) 230
BmeT110I CYCGRG 1 cut(s) 321
BmiI GGNNCC 1 cut(s) 440
BmrI ACTGGG 1 cut(s) 265
BmuI ACTGGG 1 cut(s) 265
Bsc4I CCNNNNNNNGG 1 cut(s) 402
Bse1I ACTGG 1 cut(s) 260
Bse3DI GCAATG 1 cut(s) 387
BseGI GGATG 6 cut(s) 19, 37, 49, 196, 220, 256
BseLI CCNNNNNNNGG 1 cut(s) 402
BseMI GCAATG 1 cut(s) 387
BseNI ACTGG 1 cut(s) 260
BseRI GAGGAG 1 cut(s) 327
Bsh1236I CGCG 1 cut(s) 286
BshNI GGYRCC 1 cut(s) 438
BsiHKAI GWGCWC 1 cut(s) 328
BsiHKCI CYCGRG 1 cut(s) 321
BslI CCNNNNNNNGG 1 cut(s) 402
BsmAI GTCTC 1 cut(s) 230
BsmI GAATGC 1 cut(s) 176
BsoBI CYCGRG 1 cut(s) 321
Bsp1286I GDGCHC 1 cut(s) 328
BspACI CCGC 1 cut(s) 286
BspFNI CGCG 1 cut(s) 286
BspLI GGNNCC 1 cut(s) 440
BspT107I GGYRCC 1 cut(s) 438
BsrDI GCAATG 1 cut(s) 387
BsrI ACTGG 1 cut(s) 260
BstDEI CTNAG 1 cut(s) 295
BstF5I GGATG 6 cut(s) 19, 37, 49, 196, 220, 256
BstFNI CGCG 1 cut(s) 286
BstMAI GTCTC 1 cut(s) 230
BstMWI GCNNNNNNNGC 2 cut(s) 323, 391
BstUI CGCG 1 cut(s) 286
BtsCI GGATG 6 cut(s) 19, 37, 49, 196, 220, 256
CaiI CAGNNNCTG 1 cut(s) 72
CviJI RGCY 4 cut(s) 7, 93, 143, 326
CviKI_1 RGCY 4 cut(s) 7, 93, 143, 326
DdeI CTNAG 1 cut(s) 295
Ecl136II GAGCTC 1 cut(s) 326
Eco24I GRGCYC 1 cut(s) 328
Eco53kI GAGCTC 1 cut(s) 326
Eco88I CYCGRG 1 cut(s) 321
EcoICRI GAGCTC 1 cut(s) 326
EcoT38I GRGCYC 1 cut(s) 328
FaiI YATR 2 cut(s) 11, 332
FokI GGATG 6 cut(s) 26, 44, 56, 203, 227, 263
FriOI GRGCYC 1 cut(s) 328
HinfI GANTC 4 cut(s) 19, 69, 281, 319
HphI GGTGA 2 cut(s) 290, 439
Hpy188I TCNGA 2 cut(s) 24, 68
HpyAV CCTTC 4 cut(s) 22, 181, 366, 406
HpyF10VI GCNNNNNNNGC 2 cut(s) 323, 391
HpyF3I CTNAG 1 cut(s) 295
LmnI GCTCC 3 cut(s) 4, 259, 314
LpnPI CCDG 4 cut(s) 160, 241, 355, 445
MboII GAAGA 1 cut(s) 37
MhlI GDGCHC 1 cut(s) 328
MlyI GAGTC 2 cut(s) 290, 313
MmeI TCCRAC 2 cut(s) 124, 186
MnlI CCTC 4 cut(s) 34, 160, 269, 305
MseI TTAA 1 cut(s) 195
Mva1269I GAATGC 1 cut(s) 176
MvnI CGCG 1 cut(s) 286
MwoI GCNNNNNNNGC 2 cut(s) 323, 391
NlaIV GGNNCC 1 cut(s) 440
PaeR7I CTCGAG 1 cut(s) 321
PctI GAATGC 1 cut(s) 176
PfeI GAWTC 2 cut(s) 19, 69
PleI GAGTC 2 cut(s) 289, 313
PpsI GAGTC 2 cut(s) 289, 313
Psp124BI GAGCTC 1 cut(s) 328
PspN4I GGNNCC 1 cut(s) 440
PspXI VCTCGAGB 1 cut(s) 321
PstNI CAGNNNCTG 1 cut(s) 72
SacI GAGCTC 1 cut(s) 328
SaqAI TTAA 1 cut(s) 195
SchI GAGTC 2 cut(s) 290, 313
SduI GDGCHC 1 cut(s) 328
SetI ASST 5 cut(s) 9, 95, 145, 280, 328
Sfr274I CTCGAG 1 cut(s) 321
SlaI CTCGAG 1 cut(s) 321
SmlI CTYRAG 1 cut(s) 321
SmoI CTYRAG 1 cut(s) 321
SsiI CCGC 1 cut(s) 286
SstI GAGCTC 1 cut(s) 328
TaqI TCGA 1 cut(s) 322
TfiI GAWTC 2 cut(s) 19, 69
Tru1I TTAA 1 cut(s) 195
Tru9I TTAA 1 cut(s) 195
TspDTI ATGAA 4 cut(s) 137, 231, 231, 354
TspGWI ACGGA 1 cut(s) 149
XhoI CTCGAG 1 cut(s) 321
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.