Rroxscaffold_6G00425410

No description available

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000006
Physical Location & Seq
Reverse (-)
46379633 .. 46380607
975 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_6G00425410.1

Sequence Viewer

Length: 243 bp
ATGAGTTCTTTCAAGTCAAAATGGAGTTTTTTGATTCCTCTATCTTTGTGGCTCCAGTCCTATTTCCAAAATCTTACCAAAGAAGTGATGAAACAAGAAAGGGAAATAGCTACCAGATTGGTTGCTCGTAAGGAAGAATTCGAGAGAATGTTGGAGGATGTTAAGGAGAAGTTGGAAAAGGATGAAACAAGTGAAATGGCAGAAGCTTCATTTTGGGATGACTGGGGTGTTACAAGCATCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

80

Amino Acids

9.61

Weight (kDa)

4.85

Isoelectric Point (pI)

44.03

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 137
AgsI TTSAA 1 cut(s) 13
AluBI AGCT 2 cut(s) 110, 206
AluI AGCT 2 cut(s) 110, 206
ApoI RAATTY 1 cut(s) 137
BmiI GGNNCC 1 cut(s) 53
BmrI ACTGGG 1 cut(s) 232
BmuI ACTGGG 1 cut(s) 232
BpmI CTGGAG 1 cut(s) 38
Bse1I ACTGG 2 cut(s) 55, 227
BseGI GGATG 3 cut(s) 163, 187, 223
BseNI ACTGG 2 cut(s) 55, 227
BspLI GGNNCC 1 cut(s) 53
BsrI ACTGG 2 cut(s) 55, 227
BstF5I GGATG 3 cut(s) 163, 187, 223
BtsCI GGATG 3 cut(s) 163, 187, 223
CviJI RGCY 3 cut(s) 52, 110, 206
CviKI_1 RGCY 3 cut(s) 52, 110, 206
EcoRI GAATTC 1 cut(s) 137
FokI GGATG 3 cut(s) 170, 194, 230
GsuI CTGGAG 1 cut(s) 38
HindIII AAGCTT 1 cut(s) 204
HinfI GANTC 1 cut(s) 34
Hpy188I TCNGA 1 cut(s) 242
Hpy188III TCNNGA 1 cut(s) 142
LmnI GCTCC 1 cut(s) 57
LpnPI CCDG 3 cut(s) 68, 127, 208
MaeIII GTNAC 1 cut(s) 229
MboII GAAGA 1 cut(s) 146
MluCI AATT 1 cut(s) 137
MmeI TCCRAC 2 cut(s) 132, 153
MnlI CCTC 2 cut(s) 48, 148
MseI TTAA 1 cut(s) 162
NlaIV GGNNCC 1 cut(s) 53
PfeI GAWTC 1 cut(s) 34
PspN4I GGNNCC 1 cut(s) 53
SaqAI TTAA 1 cut(s) 162
SetI ASST 2 cut(s) 112, 208
SgeI CNNG 8 cut(s) 25, 67, 107, 126, 138, 154, 201, 235
Sse9I AATT 1 cut(s) 137
TaqI TCGA 1 cut(s) 141
TasI AATT 1 cut(s) 137
TfiI GAWTC 1 cut(s) 34
Tru1I TTAA 1 cut(s) 162
Tru9I TTAA 1 cut(s) 162
TspDTI ATGAA 3 cut(s) 104, 198, 198
XapI RAATTY 1 cut(s) 137
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.