Rh2CG156900

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2C
Physical Location & Seq
Reverse (-)
13610088 .. 13610488
401 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2CG156900.1

Sequence Viewer

Length: 249 bp
ATGGAGCGTATGGATGAGATTCGGAAGAAGGATGGCGGTGGTGGTGGAGAAGTCAGATTCAGTTGTGGTGGTGGAAGTAGCTATTTCCAACATCTTACCAAAGAAGTGATGAAACAAGAAACAGAAGTAGCTACCAGATTGGTTGCTCGTAAGGAGGAATGCGAGAGAATGTTGAAGGATGTTAAGGAGAAGTTGGAAAAGGATGAAACAAGTGAAATGGCAGAGACTTCATTTTGGGATGACTGGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

82

Amino Acids

9.51

Weight (kDa)

4.95

Isoelectric Point (pI)

45.01

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 36
AgsI TTSAA 1 cut(s) 175
AluBI AGCT 2 cut(s) 81, 131
AluI AGCT 2 cut(s) 81, 131
Alw26I GTCTC 1 cut(s) 218
BccI CCATC 1 cut(s) 26
BcoDI GTCTC 1 cut(s) 218
Bse1I ACTGG 1 cut(s) 248
BseGI GGATG 5 cut(s) 19, 37, 184, 208, 244
BseNI ACTGG 1 cut(s) 248
BsmAI GTCTC 1 cut(s) 218
BsmI GAATGC 1 cut(s) 164
BspACI CCGC 1 cut(s) 36
BsrI ACTGG 1 cut(s) 248
BstF5I GGATG 5 cut(s) 19, 37, 184, 208, 244
BstMAI GTCTC 1 cut(s) 218
BtsCI GGATG 5 cut(s) 19, 37, 184, 208, 244
CviJI RGCY 2 cut(s) 81, 131
CviKI_1 RGCY 2 cut(s) 81, 131
FaiI YATR 1 cut(s) 11
FokI GGATG 4 cut(s) 26, 44, 191, 215
HinfI GANTC 2 cut(s) 19, 57
Hpy188I TCNGA 2 cut(s) 24, 56
HpyAV CCTTC 2 cut(s) 22, 169
LmnI GCTCC 1 cut(s) 4
LpnPI CCDG 2 cut(s) 148, 229
MboII GAAGA 1 cut(s) 37
MmeI TCCRAC 2 cut(s) 112, 174
MnlI CCTC 1 cut(s) 148
MseI TTAA 1 cut(s) 183
Mva1269I GAATGC 1 cut(s) 164
PctI GAATGC 1 cut(s) 164
PfeI GAWTC 2 cut(s) 19, 57
SaqAI TTAA 1 cut(s) 183
SetI ASST 2 cut(s) 83, 133
SgeI CNNG 5 cut(s) 128, 147, 159, 175, 222
SsiI CCGC 1 cut(s) 36
TfiI GAWTC 2 cut(s) 19, 57
Tru1I TTAA 1 cut(s) 183
Tru9I TTAA 1 cut(s) 183
TspDTI ATGAA 3 cut(s) 125, 219, 219
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.