Rmu_ssc0000443.1_g000025

No description available

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_ssc0000443.1
Physical Location & Seq
Forward (+)
90230 .. 90630
401 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_ssc0000443.1_g000025.1.cds

Sequence Viewer

Length: 249 bp
atggaggttatggatgagattcggaagaaggatcgcggtggtggtggagaagtcagattctgttgtggtggtggaagtagctatttccaacatcttaccaaagaagtgatgaaacaagaaacggaagtagctaccatattggttgctcgtaaggaggaatgcgagagaatgttgaaggatgttaaggagaagttggaaaaggatgaaacaagtgaaatggcagagacttcattttgggatgactggtag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

82

Amino Acids

9.53

Weight (kDa)

4.82

Isoelectric Point (pI)

39.92

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 36
AciI CCGC 1 cut(s) 36
AclWI GGATC 1 cut(s) 39
AgsI TTSAA 1 cut(s) 175
AluBI AGCT 2 cut(s) 81, 131
AluI AGCT 2 cut(s) 81, 131
Alw26I GTCTC 1 cut(s) 218
AlwI GGATC 1 cut(s) 39
AlwNI CAGNNNCTG 1 cut(s) 60
BcoDI GTCTC 1 cut(s) 218
Bse1I ACTGG 1 cut(s) 248
BseGI GGATG 4 cut(s) 19, 184, 208, 244
BseNI ACTGG 1 cut(s) 248
Bsh1236I CGCG 1 cut(s) 36
BsmAI GTCTC 1 cut(s) 218
BsmI GAATGC 1 cut(s) 164
Bsp143I GATC 1 cut(s) 31
BspACI CCGC 1 cut(s) 36
BspFNI CGCG 1 cut(s) 36
BspPI GGATC 1 cut(s) 39
BsrI ACTGG 1 cut(s) 248
BssMI GATC 1 cut(s) 31
BstF5I GGATG 4 cut(s) 19, 184, 208, 244
BstFNI CGCG 1 cut(s) 36
BstKTI GATC 1 cut(s) 34
BstMAI GTCTC 1 cut(s) 218
BstMBI GATC 1 cut(s) 31
BstUI CGCG 1 cut(s) 36
BtsCI GGATG 4 cut(s) 19, 184, 208, 244
CaiI CAGNNNCTG 1 cut(s) 60
CviJI RGCY 2 cut(s) 81, 131
CviKI_1 RGCY 2 cut(s) 81, 131
DpnI GATC 1 cut(s) 33
DpnII GATC 1 cut(s) 31
FaiI YATR 2 cut(s) 11, 137
FokI GGATG 3 cut(s) 26, 191, 215
HinfI GANTC 2 cut(s) 19, 57
Hpy188I TCNGA 2 cut(s) 24, 56
HpyAV CCTTC 2 cut(s) 22, 169
Kzo9I GATC 1 cut(s) 31
LpnPI CCDG 1 cut(s) 229
MalI GATC 1 cut(s) 33
MboI GATC 1 cut(s) 31
MboII GAAGA 1 cut(s) 37
MmeI TCCRAC 2 cut(s) 112, 174
MnlI CCTC 1 cut(s) 148
MseI TTAA 1 cut(s) 183
Mva1269I GAATGC 1 cut(s) 164
MvnI CGCG 1 cut(s) 36
NdeII GATC 1 cut(s) 31
PctI GAATGC 1 cut(s) 164
PfeI GAWTC 2 cut(s) 19, 57
PstNI CAGNNNCTG 1 cut(s) 60
SaqAI TTAA 1 cut(s) 183
Sau3AI GATC 1 cut(s) 31
SetI ASST 3 cut(s) 9, 83, 133
SgeI CNNG 5 cut(s) 47, 128, 159, 175, 222
SsiI CCGC 1 cut(s) 36
TfiI GAWTC 2 cut(s) 19, 57
Tru1I TTAA 1 cut(s) 183
Tru9I TTAA 1 cut(s) 183
TspDTI ATGAA 3 cut(s) 125, 219, 219
TspGWI ACGGA 1 cut(s) 137
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.