Rh3BG033100

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3B
Physical Location & Seq
Forward (+)
2215862 .. 2216274
413 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3BG033100.1

Sequence Viewer

Length: 261 bp
ATGGAGCTTATGGATGAGATTCGGAAGAAGGATGGCGTGGAGGATGGCGGTGGTGGTGGAGAAGTCAGATTCTATTGTGGTGGTGGAAGTAGCTATTTCCAACATCTTACCAAAGAAGTGATGAAACAAGAAACGGAAGTAGCTACCAGATTGGTTGCTCGTAAGGAGGAATGCGAGAGAATGTTGAAGGATGTTAAGGAGAAGTTGGAAAAGGATGAAACAAGTGAAATGGTAGAGACTTCATTTTGGGATAACTGGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

86

Amino Acids

9.97

Weight (kDa)

4.75

Isoelectric Point (pI)

42.98

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 48
AgsI TTSAA 1 cut(s) 187
AluBI AGCT 3 cut(s) 7, 93, 143
AluI AGCT 3 cut(s) 7, 93, 143
Alw26I GTCTC 1 cut(s) 230
BccI CCATC 2 cut(s) 26, 38
BcoDI GTCTC 1 cut(s) 230
Bse1I ACTGG 1 cut(s) 260
BseGI GGATG 5 cut(s) 19, 37, 49, 196, 220
BseNI ACTGG 1 cut(s) 260
BsmAI GTCTC 1 cut(s) 230
BsmI GAATGC 1 cut(s) 176
BspACI CCGC 1 cut(s) 48
BsrI ACTGG 1 cut(s) 260
BstF5I GGATG 5 cut(s) 19, 37, 49, 196, 220
BstMAI GTCTC 1 cut(s) 230
BtsCI GGATG 5 cut(s) 19, 37, 49, 196, 220
CviJI RGCY 3 cut(s) 7, 93, 143
CviKI_1 RGCY 3 cut(s) 7, 93, 143
FaiI YATR 1 cut(s) 11
FokI GGATG 5 cut(s) 26, 44, 56, 203, 227
HinfI GANTC 2 cut(s) 19, 69
Hpy188I TCNGA 2 cut(s) 24, 68
HpyAV CCTTC 2 cut(s) 22, 181
LmnI GCTCC 1 cut(s) 4
LpnPI CCDG 2 cut(s) 160, 241
MboII GAAGA 1 cut(s) 37
MmeI TCCRAC 2 cut(s) 124, 186
MnlI CCTC 2 cut(s) 34, 160
MseI TTAA 1 cut(s) 195
Mva1269I GAATGC 1 cut(s) 176
PctI GAATGC 1 cut(s) 176
PfeI GAWTC 2 cut(s) 19, 69
SaqAI TTAA 1 cut(s) 195
SetI ASST 3 cut(s) 9, 95, 145
SgeI CNNG 6 cut(s) 49, 140, 159, 171, 187, 234
SsiI CCGC 1 cut(s) 48
TfiI GAWTC 2 cut(s) 19, 69
Tru1I TTAA 1 cut(s) 195
Tru9I TTAA 1 cut(s) 195
TspDTI ATGAA 3 cut(s) 137, 231, 231
TspGWI ACGGA 1 cut(s) 149
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.