Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0004479.1

Orthogroup ID

OG0005209

Physical Location & Seq

Genomic Coordinates Reverse (-)

23323 .. 23839

Gene Structure 517 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0004479.1_g000007.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 261 bp

atgagttctttcaagtcaaaatggagttttgtgattcctctatctttttggctccagtcctatttccaaaatcttaccaaagaagtgatgaaacaagaaatggaaatagctaccagattggttgctcgtaaggaggaatacgagagaatgttggagaatgttagaatgctggaggatgttaaggagaagttggaaaaggacgaaacaagtgaaatggcagaagcttcattttgggatgactggggtgttacaagcatctga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

86

Amino Acids

10.37

Weight (kDa)

4.76

Isoelectric Point (pI)

38.03

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0005209)

Species	Orthologous Gene IDs
rosa_chinensis	RchiOBHm_Chr3g0454181 RchiOBHm_Chr6g0307821
rosa_laevigata	RLG00000025477
rosa_multiflora	Rmu_sc0002277.1_g000014 Rmu_sc0002277.1_g000015 Rmu_sc0004479.1_g000007 Rmu_sc0004483.1_g000001 Rmu_sc0006536.1_g000036 Rmu_ssc0000443.1_g000025
rosa_roxburghii	Rroxscaffold_165G00436960 Rroxscaffold_1G00047680 Rroxscaffold_6G00425410
rosa_rugosa	Rorug05G0188200 Rorug07G0270700
rosa_samantha	Rh2AG431300 Rh2BG593100 Rh2CG156900 Rh2CG417200 Rh2DG449800 Rh3AG032900 Rh3AG158200 Rh3BG033100 Rh3BG182500 Rh3CG032000 Rh3CG173200 Rh3DG032900 Rh5BG425800 Rh5CG449900 Rh6AG432300 Rh7AG433200

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AgsI	TTSAA	1 cut(s)	13
AluBI	AGCT	2 cut(s)	110, 224
AluI	AGCT	2 cut(s)	110, 224
BmiI	GGNNCC	1 cut(s)	53
BmrI	ACTGGG	1 cut(s)	250
BmuI	ACTGGG	1 cut(s)	250
BpmI	CTGGAG	2 cut(s)	38, 191
Bse1I	ACTGG	2 cut(s)	55, 245
BseGI	GGATG	2 cut(s)	181, 241
BseNI	ACTGG	2 cut(s)	55, 245
BsmI	GAATGC	1 cut(s)	171
BspLI	GGNNCC	1 cut(s)	53
BsrI	ACTGG	2 cut(s)	55, 245
BstF5I	GGATG	2 cut(s)	181, 241
BtsCI	GGATG	2 cut(s)	181, 241
CviJI	RGCY	3 cut(s)	52, 110, 224
CviKI_1	RGCY	3 cut(s)	52, 110, 224
FokI	GGATG	2 cut(s)	188, 248
GsuI	CTGGAG	2 cut(s)	38, 191
HindIII	AAGCTT	1 cut(s)	222
HinfI	GANTC	1 cut(s)	34
Hpy188I	TCNGA	1 cut(s)	260
LmnI	GCTCC	1 cut(s)	57
LpnPI	CCDG	4 cut(s)	68, 127, 155, 226
MaeIII	GTNAC	1 cut(s)	247
MmeI	TCCRAC	2 cut(s)	132, 171
MnlI	CCTC	3 cut(s)	48, 127, 166
MseI	TTAA	1 cut(s)	180
Mva1269I	GAATGC	1 cut(s)	171
NlaIV	GGNNCC	1 cut(s)	53
PctI	GAATGC	1 cut(s)	171
PfeI	GAWTC	1 cut(s)	34
PspN4I	GGNNCC	1 cut(s)	53
SaqAI	TTAA	1 cut(s)	180
SetI	ASST	2 cut(s)	112, 226
SgeI	CNNG	9 cut(s)	25, 67, 107, 126, 138, 154, 182, 219, 253
TfiI	GAWTC	1 cut(s)	34
Tru1I	TTAA	1 cut(s)	180
Tru9I	TTAA	1 cut(s)	180
TspDTI	ATGAA	2 cut(s)	104, 216

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.