Rmu_sc0002290.1_g000003

ATPase family associated with various cellular activities (AAA)

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0002290.1
Physical Location & Seq
Reverse (-)
4383 .. 16529
12147 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0002290.1_g000003.1.cds

Sequence Viewer

Length: 6285 bp
atgcgatcgtcgccgagtggtggtaaacagtgggggcagaggaatcggaagaagcacaagaggcttgatgctattagtgaaaccgtgtataagaggaatcatcttcaggctaatgatggggcggggccgggtcccgggagcggtgaatcggagcttcggaggagctccagggcaaattcttcagttcaagaaattgttgttgtgatgcgatcgtcgccgagtggtggtaaacagtgggggcagaggaatcggaagaagcacaagaggcttgatgctattagtgaaaccgtgtataagaggaatcatcttcaggctaatgatggggcggggccgggtcccgggagcggtgaatcggagcttcggaggagctccagggcacgccgggcccccgttgtgcttgatttgtccccggggccgccgaagaagaggaggaggcttgaaattgttgttgtgatgcgatcgtcgccgagtggtggtaaacagtgggggcagaggaatcggaagaagcacaagaggcttgatgctattagtgaaaccgtgtataagaggaatcatcttcaggctaatgatggggcggggccgggtcccgggagcggtgaatcggagcttcggaggagctccagggcacgccgggcccccgttgtgcttgatttgtccccggggccgccgaagaagaggaggaggcttggtaagaatgggagattgagtggggggaagaatgtgaaggaggaggaggaggaggaggaggaggaggtggagggagggtggaagtcgaggttgagatcgaggagggggcattcggggtttgtgaaagggaagaggaagctatttgaagatgtgagtggaggtagtagtggagggaaggtagtggggagtgagctggatgatgagaatgaggaagggttggaaggtgggaggccgaaagttgtgaagtcgaagagaccagggagggaagaatgtgaaggaggaggaggaggaggaggaggaggaggtggagggagggtggaagtcgaggttgagatcgaggagggggcattcggggtagtggggagtgagctggatgatgagaatgaggaagggttggaaggtgggaggccgaaggttgtgaagtcgaagagaccagggagggttagagcaacgcatggttcggagcatgaagagaatgagttgcttgaagttaaggaggaagttgtgggggaagaagaggaagtgatgagggaggacatggataatttgatgcagttggattgcgaagatgatggtggaattgagagggaaactgtggaaggtgattccacaaagataattgaggcggtggaggatttacagttagaggaggagtgcactggcaatgagaaagtggaagctgctgaaactgcaggtggtggggaaaccatggaacaagttgatgaacagttggagcaatcagttgatgtgattgaagaagaaaaagatgatgtgattgaagaagaaaaagatgataaacagatggaacaagagcaagtaccgtgtgttgttgaaggagaagatcaaagtgaggccatagaagctgttggagtccccagagatgaagcggaagttgaaggttgtcatgatgggaaggattcgcatttgactgagcatgatggaaaacttccaatagaagtgaatactgtgaaggtggacatgtccaaagatggaaagtcacagattaaagagggcagacgatgtggtttgtgtgggggagggactgatggtatgcctccaaaaattttagctcaggatacagttgacattgagaatgaagcgtatagtggctcttcagcctctgagaaatttgactataacatatgggatggttttggtgatgaacctggctggcttggacgtctcttgggtccaataaatgatcgttatggcattgctggaacatgggttcatcaacactgtgctgtatggagtccagaggtttactttgcgggtgtaggatgcttaaaaaatataagggccgctctgtgcagagggagagcgttaaaatgcacccgctgtggaaggccaggagcaactattggatgccgtgttgatcggtgttcaagaacttaccacttgccttgtgcacgagctatgaattgcgtatttgatcatcgcaagtttcttattgcctgtactggtcataggaaactcttccagcctcttggttatcagtacttggcccgcaaaaagaaattgaaggttaagaaaatgaagttcgaaatcagaaagctatcaaatgatgctttgcgaaaggatattgaggcagaagaaaagtggttggagaattgtggcgatgatgaagagtttttgaaacgtgaaagcaagaggctacatcgagatttggtgagaattgcacctgtgtacattggaggctccgactctgagagtggcaaactgtttcagggttgggaatctgttgcaggtcttcaaaatgtcattagatgtatgaaggaagttgtcatattacctcttctatatccagagttctttgatagtctcagcctaacacctcctagaggtgttctattgcatgggtatcctggaacaggtaaaactcttgttgtgcgggcattaataggtgcatgtgcacgtggtgatagacgaatagcatattttgctcgtaaaggtgctgattgtttaggaaaatatgttggtgatgctgagcgccagctaagactcttgtttcaggttgctgagagatgtcaaccttctataatattctttgatgagattgatgggttggcaccttccagaactaggcaacaagatcagacacatagttcagttgtgtcaacactgcttgctttaatggatggtttgaaatctcgaggttctgttgtagtgataggtgctacaaatcgtcctgatgctgttgatccagcactaaggcggcctggaagatttgatagggaaatctattttccactaccgtcagaagaggacagagcttccattctttctgttcatactcaaaaatggcccaaaccagtcagtggatccgtgcttaagtcgattgcaagaggaactgctggatttgctggtgcagatctgcaggcactttgcactcaagcagccataatttctttgaaaaggaatttccctttgcaagaagttttgtctgctgctggaaagaaagattccgagtccaaacgcctccctctacctgcctttctagtggaggacagggattggctggaggctctgacatgttctccacctccctgctctcgtagggaagtaggaatagctgctaatgaagtaatatgctctcctcttccaacccaccttatcccatgtcttctgcaaccattatctaccatgctcgtatccctttatcttgatgaacggctctggttgccaactcctctgagaagagctgcaacaatgattgaaagtgtggttgtttctgccttgaataggaaaaatatgctcagtgatcgctggtggtcccatattgatgttttacttcaggaagcagatgttgcaaaggacatagagagaaagcttttgcatgctggaatcttacatggagatactgctcttgctgattctgatgtttgcaatgatgatgttgatgacggaattttgaattttgagccttctgttaaacatcatggtggtactcgcccaagtttgttgcaaaacacatttgttgcctcaacgtacaaaccgggatttcggatattgattgctggaaatcccagatctggccaaaggcatcttgcttcctgccttcttcactgttttgttgggaatgtagaaatccagaaggttgatttggcaacagttttgctagaaggacacggagatatggcgcaagggataacacaaatattaaagaaatgtgccagcatggggtcgtgtatagttttcatgccaagaattgatttgtgggcagtggagacacctaatcaagtaacagaagacagtgatgcagatttatcaaaccatcaatgtcctgaaaatgaaaagcatcaacatcctgagaatgaaaagtcatattttgcgcgtggtctggaggaaagtgtgtccttatcacagcaatgcaaatcagaagaaatgttagagtgccaagatgatgttgctcagagtgcttcacatgcttggaacttgtttgtggagcaggtggagtctctaagtgtctctgcatccttaatgattctggctacatcagaagttccatgtccagtgcttccagttagaataaggcagttctttaagagtgacattttaaatggccatcggtcagttcctgtgaagcatacagttcccaggttttctgtgcaggttgatggaaatttcaaccatgatctggtgatcaatctatcttcagcagagttatcaagggatcttgttcaacagattgttctgttagttcatcaaacttctcacattcatacaacttcatgcaaggagagaggctttcatggtataaatggtcagtccaagatggttgattacagtgcagatcatggatcagctgatggaaacaacaatttaactctacctcctgttgattctcttcttaaagcttctgcaccacctaacaatataactggaaatgggaaatcaagccttctgctagcaatatcttcatttggctatcagatactgcgatatcctcattttgctgaactttgttggttcacttcaaaacttaaagaaggtccttctgcagacataagtggaccttggaagggttggccattcaattcctgtatagttcgtcctaacagctcgctagaaatggtaactgtggcaaagaatattaaaagcaaagaaaacttgggcctagttagaggcctgattgctgttggtttatcggcatatagaggtctctacacatctctcagagaagtctcttctgaggtacggaaggttcttgagattctagttgcgcagatcaatgcaaaagttcaagccgggaaagatagatatcaatatgttcgccttttgtcacaagtggcttatctggaagatgtggtcaatagctgggcatacaccttgcagagtttagagcaggatgctccattggcagatgctaagcttaccgctccgagacttccagacgataaccatatggatgatcaagttcaaagcgaggattccaagccaaaggttacaagcaaatgctccagtgagcacgaagtgctggaaattgtccctgaagggtttgatgctgcaaaagttgtcagtattgacttgaatgaacaagttgctgatttgggttgttctgaggttagacttgcaagtttagattgttctggacagaagattgtcccatctgattctaccctggataattgtcttaaagattcagatgaagttttgaatgaccagaatgggacaaaccctaaaccccacgagtcagaaaatgacaaacaccatacagttgttgcaggagattctgaatctttgaaatgtccaaatggatttgaatgcactgaatctgttgctattcccgaggacagtccgacttctgatatatttggcagcattaagctctctagttctttgaccagttacaacaaccttaatggtttgtccttgacagaggctggtagtagacataatgatggtaaggctgatgctcatgaggttactgcagacgtcaactttccaagcaccaccagtaaaaccaatctgcctgagtgcatagataagcctgatgcaaacttctcaagtaaaaccaatgctgatgtgcataatgttgatgtcaacttccctcccaaaatcagtccctctacgaagtctgagtttgtatgcgtatatcattgttgctctgaatgcctagatacccttcacagtttgacacagaaaattcttatcgaggagtggcgatcaaatgggagccaatggacagtggaggatgttcatgatattgtggcatcactatctgtggatcttctttcagcggttagaagaattcatgtttccggaggtttcaacagttcatttggtgataaaaggagacacagaaatactgaaacatatgagtggccggaatcaggaacatgtgattgcaatatctcagaaaataagattctttcacctgctgaatgtagatgccacaccagcagggagagctttactcaaaagacaaatgcttccgcaaatactcatctcaggtttgattcaaaatttgtttttcgagatggtttgctggttcatatgcatccagataaagatgtttctttccactgtaaattcgagacgctctgcctctgttcacttatagagttgatagtaatgaccaagtcaccttttcattga

Protein Analysis

2094

Amino Acids

230.64

Weight (kDa)

5.84

Isoelectric Point (pI)

54.54

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AarI CACCTGC 3 cut(s) 1370, 4126, 6073
AatII GACGTC 2 cut(s) 1870, 5625
Acc16I TGCGCA 1 cut(s) 4911
Acc36I ACCTGC 6 cut(s) 1370, 2423, 3184, 4126, 4288, 6073
AccB1I GGYRCC 1 cut(s) 2755
AccB7I CCANNNNNTGG 2 cut(s) 3005, 4324
AccBSI CCGCTC 5 cut(s) 141, 345, 594, 1991, 5066
AccI GTMKAC 1 cut(s) 5578
AccII CGCG 1 cut(s) 4021
AccIII TCCGGA 1 cut(s) 5948
AclWI GGATC 6 cut(s) 2882, 3003, 3016, 4368, 4495, 5922
AcoI YGGCCR 4 cut(s) 3721, 4249, 4715, 6011
AcuI CTGAAG 8 cut(s) 89, 165, 293, 542, 1785, 3464, 4326, 5199
AcvI CACGTG 1 cut(s) 2603
AcyI GRCGYC 2 cut(s) 1867, 5622
AdeI CACNNNGTG 2 cut(s) 2606, 5161
AfaI GTAC 7 cut(s) 1506, 2146, 2186, 2375, 3634, 3677, 4884
AflII CTTAAG 1 cut(s) 3017
AflIII ACRYGT 3 cut(s) 1665, 3218, 6026
AjuI GAANNNNNNNTTGG 2 cut(s) 3773, 3805
AloI GAACNNNNNNTCC 2 cut(s) 1899, 1931
Alw21I GWGCWC 7 cut(s) 167, 371, 620, 1346, 2098, 2602, 5157
Alw44I GTGCAC 3 cut(s) 1342, 2094, 2598
AlwI GGATC 6 cut(s) 2882, 3003, 3016, 4368, 4495, 5922
AlwNI CAGNNNCTG 4 cut(s) 1808, 4265, 4624, 5570
Ama87I CYCGRG 7 cut(s) 134, 338, 409, 587, 658, 2838, 5474
Aor13HI TCCGGA 1 cut(s) 5948
ApaI GGGCCC 2 cut(s) 388, 637
ApaLI GTGCAC 3 cut(s) 1342, 2094, 2598
ApeKI GCWGC 7 cut(s) 1367, 3083, 3134, 3260, 3389, 5192, 5505
AseI ATTAAT 1 cut(s) 2585
Asp700I GAANNNNTTC 1 cut(s) 2162
AspLEI GCGC 4 cut(s) 2679, 3829, 4021, 4912
AsuII TTCGAA 1 cut(s) 2229
AsuNHI GCTAGC 1 cut(s) 4594
AvaI CYCGRG 7 cut(s) 134, 338, 409, 587, 658, 2838, 5474
AvaII GGWCC 7 cut(s) 131, 335, 584, 1877, 3459, 4679, 4700
BaeGI GKGCMC 7 cut(s) 379, 388, 628, 637, 1346, 2098, 2602
BalI TGGCCA 3 cut(s) 3723, 4251, 4717
BamHI GGATCC 1 cut(s) 3008
BanI GGYRCC 1 cut(s) 2755
BanII GRGCYC 5 cut(s) 167, 371, 388, 620, 637
BauI CACGAG 2 cut(s) 2097, 5375
BbrPI CACGTG 1 cut(s) 2603
BbsI GAAGAC 3 cut(s) 2429, 3302, 3942
Bbv12I GWGCWC 7 cut(s) 167, 371, 620, 1346, 2098, 2602, 5157
BbvI GCAGC 7 cut(s) 1354, 3095, 3121, 3247, 3376, 5179, 5517
BceAI ACGGC 2 cut(s) 2040, 3374
BcgI CGANNNNNNTGC 6 cut(s) 26, 60, 230, 264, 479, 513
BciVI GTATCC 3 cut(s) 1756, 2559, 3349
BclI TGATCA 3 cut(s) 2119, 4329, 5098
BfmI CTRYAG 4 cut(s) 1377, 3062, 4686, 5616
BfoI RGCGCY 1 cut(s) 2680
BfrI CTTAAG 1 cut(s) 3017
BfuAI ACCTGC 6 cut(s) 1370, 2423, 3184, 4126, 4288, 6073
BfuI GTATCC 3 cut(s) 1756, 2559, 3349
BglII AGATCT 2 cut(s) 3058, 3716
BlpI GCTNAGC 2 cut(s) 2673, 5055
BmcAI AGTACT 1 cut(s) 2186
Bme18I GGWCC 7 cut(s) 131, 335, 584, 1877, 3459, 4679, 4700
BmeT110I CYCGRG 7 cut(s) 134, 338, 409, 587, 658, 2838, 5474
BmtI GCTAGC 1 cut(s) 4598
BpiI GAAGAC 3 cut(s) 2429, 3302, 3942
BplI GAGNNNNNCTC 2 cut(s) 6088, 6120
BpmI CTGGAG 6 cut(s) 151, 355, 604, 3227, 4049, 5131
Bpu10I CCTNAGC 1 cut(s) 1758
Bpu1102I GCTNAGC 2 cut(s) 2673, 5055
Bpu14I TTCGAA 1 cut(s) 2229
BpuEI CTTGAG 3 cut(s) 3063, 4916, 5677
BsaAI YACGTR 1 cut(s) 2603
BsaBI GATNNNNATC 1 cut(s) 4947
BsaHI GRCGYC 2 cut(s) 1867, 5622
BsaI GGTCTC 3 cut(s) 934, 1111, 4853
BsaWI WCCGGW 1 cut(s) 5948
Bse1I ACTGG 9 cut(s) 1351, 2152, 2999, 4199, 4208, 4573, 5148, 5532, 5643
Bse3DI GCAATG 4 cut(s) 1357, 1899, 3580, 4061
Bse8I GATNNNNATC 1 cut(s) 4947
BseAI TCCGGA 1 cut(s) 5948
BseJI GATNNNNATC 1 cut(s) 4947
BseMI GCAATG 4 cut(s) 1357, 1899, 3580, 4061
BseNI ACTGG 9 cut(s) 1351, 2152, 2999, 4199, 4208, 4573, 5148, 5532, 5643
BseSI GKGCMC 7 cut(s) 379, 388, 628, 637, 1346, 2098, 2602
BseXI GCAGC 7 cut(s) 1354, 3095, 3121, 3247, 3376, 5179, 5517
BseYI CCCAGC 1 cut(s) 5004
BsgI GTGCAG 5 cut(s) 2017, 3075, 4316, 4497, 4533
Bsh1236I CGCG 1 cut(s) 4021
Bsh1285I CGRYCG 3 cut(s) 8, 212, 461
BshNI GGYRCC 1 cut(s) 2755
BsiEI CGRYCG 3 cut(s) 8, 212, 461
BsiHKAI GWGCWC 7 cut(s) 167, 371, 620, 1346, 2098, 2602, 5157
BsiHKCI CYCGRG 7 cut(s) 134, 338, 409, 587, 658, 2838, 5474
BsmBI CGTCTC 2 cut(s) 1874, 6218
BsmI GAATGC 4 cut(s) 796, 1034, 5456, 5804
Bso31I GGTCTC 3 cut(s) 934, 1111, 4853
BsoBI CYCGRG 7 cut(s) 134, 338, 409, 587, 658, 2838, 5474
Bsp119I TTCGAA 1 cut(s) 2229
Bsp120I GGGCCC 2 cut(s) 384, 633
Bsp13I TCCGGA 1 cut(s) 5948
Bsp1407I TGTACA 1 cut(s) 2373
Bsp1720I GCTNAGC 2 cut(s) 2673, 5055
Bsp19I CCATGG 1 cut(s) 1395
BspEI TCCGGA 1 cut(s) 5948
BspFNI CGCG 1 cut(s) 4021
BspHI TCATGA 3 cut(s) 1591, 5605, 5887
BspMAI CTGCAG 4 cut(s) 1381, 3066, 4690, 5620
BspMI ACCTGC 6 cut(s) 1370, 2423, 3184, 4126, 4288, 6073
BspOI GCTAGC 1 cut(s) 4598
BspPI GGATC 6 cut(s) 2882, 3003, 3016, 4368, 4495, 5922
BspQI GCTCTTC 2 cut(s) 1804, 3379
BspT104I TTCGAA 1 cut(s) 2229
BspT107I GGYRCC 1 cut(s) 2755
BspTI CTTAAG 1 cut(s) 3017
BspTNI GGTCTC 3 cut(s) 934, 1111, 4853
BsrBI CCGCTC 5 cut(s) 141, 345, 594, 1991, 5066
BsrDI GCAATG 4 cut(s) 1357, 1899, 3580, 4061
BsrGI TGTACA 1 cut(s) 2373
BsrI ACTGG 9 cut(s) 1351, 2152, 2999, 4199, 4208, 4573, 5148, 5532, 5643
BssNI GRCGYC 2 cut(s) 1867, 5622
BssSI CACGAG 2 cut(s) 2097, 5375
BssT1I CCWWGG 2 cut(s) 1395, 4703
Bst2BI CACGAG 2 cut(s) 2097, 5375
BstACI GRCGYC 2 cut(s) 1867, 5622
BstAFI CTTAAG 1 cut(s) 3017
BstAPI GCANNNNNTGC 3 cut(s) 2627, 3494, 5161
BstAUI TGTACA 1 cut(s) 2373
BstBAI YACGTR 1 cut(s) 2603
BstBI TTCGAA 1 cut(s) 2229
BstDSI CCRYGG 1 cut(s) 1395
BstENI CCTNNNNNAGG 3 cut(s) 2526, 2556, 3427
BstFNI CGCG 1 cut(s) 4021
BstH2I RGCGCY 1 cut(s) 2680
BstHHI GCGC 4 cut(s) 2679, 3829, 4021, 4912
BstMCI CGRYCG 3 cut(s) 8, 212, 461
BstNSI RCATGY 6 cut(s) 1669, 2598, 3222, 3527, 4115, 6030
BstSFI CTRYAG 4 cut(s) 1377, 3062, 4686, 5616
BstSLI GKGCMC 7 cut(s) 379, 388, 628, 637, 1346, 2098, 2602
BstUI CGCG 1 cut(s) 4021
BstV1I GCAGC 7 cut(s) 1354, 3095, 3121, 3247, 3376, 5179, 5517
BstV2I GAAGAC 3 cut(s) 2429, 3302, 3942
BstX2I RGATCY 5 cut(s) 3008, 3058, 3716, 4360, 5914
BstXI CCANNNNNNTGG 1 cut(s) 2174
BstYI RGATCY 5 cut(s) 3008, 3058, 3716, 4360, 5914
BsuI GTATCC 3 cut(s) 1756, 2559, 3349
BtgI CCRYGG 1 cut(s) 1395
BtgZI GCGATG 2 cut(s) 2108, 2319
BtsI GCAGTG 2 cut(s) 2807, 3915
BveI ACCTGC 6 cut(s) 1370, 2423, 3184, 4126, 4288, 6073
CaiI CAGNNNCTG 4 cut(s) 1808, 4265, 4624, 5570
CciI TCATGA 3 cut(s) 1591, 5605, 5887
CfoI GCGC 4 cut(s) 2679, 3829, 4021, 4912
Cfr9I CCCGGG 5 cut(s) 134, 338, 409, 587, 658
CseI GACGC 1 cut(s) 6235
Csp6I GTAC 7 cut(s) 1505, 2145, 2185, 2374, 3633, 3676, 4883
CspCI CAANNNNNGTGG 2 cut(s) 2072, 2107
CviQI GTAC 7 cut(s) 1505, 2145, 2185, 2374, 3633, 3676, 4883
DraI TTTAAA 1 cut(s) 4245
DraIII CACNNNGTG 2 cut(s) 2606, 5161
EaeI YGGCCR 4 cut(s) 3721, 4249, 4715, 6011
Ecl136II GAGCTC 3 cut(s) 165, 369, 618
Eco130I CCWWGG 2 cut(s) 1395, 4703
Eco147I AGGCCT 1 cut(s) 4815
Eco24I GRGCYC 5 cut(s) 167, 371, 388, 620, 637
Eco31I GGTCTC 3 cut(s) 934, 1111, 4853
Eco32I GATATC 2 cut(s) 4631, 4949
Eco47I GGWCC 7 cut(s) 131, 335, 584, 1877, 3459, 4679, 4700
Eco53kI GAGCTC 3 cut(s) 165, 369, 618
Eco57I CTGAAG 8 cut(s) 89, 165, 293, 542, 1785, 3464, 4326, 5199
Eco72I CACGTG 1 cut(s) 2603
Eco88I CYCGRG 7 cut(s) 134, 338, 409, 587, 658, 2838, 5474
EcoICRI GAGCTC 3 cut(s) 165, 369, 618
EcoNI CCTNNNNNAGG 3 cut(s) 2526, 2556, 3427
EcoO109I RGGNCCY 6 cut(s) 131, 335, 385, 584, 634, 4679
EcoRI GAATTC 1 cut(s) 5937
EcoRV GATATC 2 cut(s) 4631, 4949
EcoT14I CCWWGG 2 cut(s) 1395, 4703
EcoT22I ATGCAT 1 cut(s) 6189
EcoT38I GRGCYC 5 cut(s) 167, 371, 388, 620, 637
ErhI CCWWGG 2 cut(s) 1395, 4703
Esp3I CGTCTC 2 cut(s) 1874, 6218
FalI AAGNNNNNCTT 2 cut(s) 4687, 4719
FauI CCCGC 7 cut(s) 115, 319, 568, 1951, 2030, 2201, 2571
FauNDI CATATG 4 cut(s) 1829, 5091, 6004, 6183
FbaI TGATCA 3 cut(s) 2119, 4329, 5098
FblI GTMKAC 1 cut(s) 5578
FriOI GRGCYC 5 cut(s) 167, 371, 388, 620, 637
FspI TGCGCA 1 cut(s) 4911
GlaI GCGC 4 cut(s) 2678, 3828, 4020, 4911
GsaI CCCAGC 1 cut(s) 5008
GsuI CTGGAG 6 cut(s) 151, 355, 604, 3227, 4049, 5131
HaeII RGCGCY 1 cut(s) 2680
HgaI GACGC 1 cut(s) 6235
HhaI GCGC 4 cut(s) 2679, 3829, 4021, 4912
Hin1I GRCGYC 2 cut(s) 1867, 5622
Hin6I GCGC 4 cut(s) 2677, 3827, 4019, 4910
HinP1I GCGC 4 cut(s) 2677, 3827, 4019, 4910
HincII GTYRAC 5 cut(s) 1771, 2717, 2805, 5626, 5731
HindII GTYRAC 5 cut(s) 1771, 2717, 2805, 5626, 5731
HindIII AAGCTT 3 cut(s) 3515, 4542, 5057
Hpy99I CGWCG 3 cut(s) 13, 217, 466
HpyCH4IV ACGT 5 cut(s) 1867, 2326, 2602, 3674, 5622
HpySE526I ACGT 5 cut(s) 1867, 2326, 2602, 3674, 5622
Hsp92I GRCGYC 2 cut(s) 1867, 5622
HspAI GCGC 4 cut(s) 2677, 3827, 4019, 4910
KflI GGGWCCC 3 cut(s) 131, 335, 584
Kpn2I TCCGGA 1 cut(s) 5948
Ksp22I TGATCA 3 cut(s) 2119, 4329, 5098
LguI GCTCTTC 2 cut(s) 1804, 3379
Lsp1109I GCAGC 7 cut(s) 1354, 3095, 3121, 3247, 3376, 5179, 5517
MaeII ACGT 5 cut(s) 1867, 2326, 2602, 3674, 5622
MaeIII GTNAC 9 cut(s) 1683, 3928, 4235, 4762, 4968, 5131, 5534, 5611, 6270
MbiI CCGCTC 5 cut(s) 141, 345, 594, 1991, 5066
MflI RGATCY 5 cut(s) 3008, 3058, 3716, 4360, 5914
MlsI TGGCCA 3 cut(s) 3723, 4251, 4717
MluNI TGGCCA 3 cut(s) 3723, 4251, 4717
MlyI GAGTC 7 cut(s) 1566, 1948, 2384, 2682, 3164, 4151, 5387
MmeI TCCRAC 9 cut(s) 885, 1062, 1224, 1398, 1534, 2271, 2412, 3314, 5510
Mox20I TGGCCA 3 cut(s) 3723, 4251, 4717
Mph1103I ATGCAT 1 cut(s) 6189
MroI TCCGGA 1 cut(s) 5948
MroXI GAANNNNTTC 1 cut(s) 2162
MscI TGGCCA 3 cut(s) 3723, 4251, 4717
MslI CAYNNNNRTG 6 cut(s) 3468, 3627, 4054, 5094, 5586, 6007
Msp20I TGGCCA 3 cut(s) 3723, 4251, 4717
MspA1I CMGCKG 3 cut(s) 2025, 4493, 5927
MspCI CTTAAG 1 cut(s) 3017
Mva1269I GAATGC 4 cut(s) 796, 1034, 5456, 5804
MvnI CGCG 1 cut(s) 4021
NcoI CCATGG 1 cut(s) 1395
NdeI CATATG 4 cut(s) 1829, 5091, 6004, 6183
NheI GCTAGC 1 cut(s) 4594
NmeAIII GCCGAG 3 cut(s) 39, 243, 492
NmuCI GTSAC 4 cut(s) 1683, 4235, 4968, 6270
NsbI TGCGCA 1 cut(s) 4911
NsiI ATGCAT 1 cut(s) 6189
NspI RCATGY 6 cut(s) 1669, 2598, 3222, 3527, 4115, 6030
NspV TTCGAA 1 cut(s) 2229
PaeI GCATGC 1 cut(s) 3527
PaeR7I CTCGAG 1 cut(s) 2838
PagI TCATGA 3 cut(s) 1591, 5605, 5887
PaqCI CACCTGC 3 cut(s) 1370, 4126, 6073
PceI AGGCCT 1 cut(s) 4815
PciI ACATGT 3 cut(s) 1665, 3218, 6026
PciSI GCTCTTC 2 cut(s) 1804, 3379
PctI GAATGC 4 cut(s) 796, 1034, 5456, 5804
PdmI GAANNNNTTC 1 cut(s) 2162
PflFI GACNNNGTC 1 cut(s) 6268
PflMI CCANNNNNTGG 2 cut(s) 3005, 4324
PfoI TCCNGGA 1 cut(s) 2551
Ple19I CGATCG 3 cut(s) 8, 212, 461
PleI GAGTC 7 cut(s) 1565, 1947, 2384, 2682, 3163, 4150, 5386
PmaCI CACGTG 1 cut(s) 2603
PmlI CACGTG 1 cut(s) 2603
PpsI GAGTC 7 cut(s) 1565, 1947, 2384, 2682, 3163, 4150, 5386
Ppu21I YACGTR 1 cut(s) 2603
PpuMI RGGWCCY 4 cut(s) 131, 335, 584, 4679
PscI ACATGT 3 cut(s) 1665, 3218, 6026
PshBI ATTAAT 1 cut(s) 2585
Psp124BI GAGCTC 3 cut(s) 167, 371, 620
Psp5II RGGWCCY 4 cut(s) 131, 335, 584, 4679
PspCI CACGTG 1 cut(s) 2603
PspFI CCCAGC 1 cut(s) 5004
PspOMI GGGCCC 2 cut(s) 384, 633
PspPPI RGGWCCY 4 cut(s) 131, 335, 584, 4679
PsrI GAACNNNNNNTAC 2 cut(s) 4875, 4907
PstI CTGCAG 4 cut(s) 1381, 3066, 4690, 5620
PstNI CAGNNNCTG 4 cut(s) 1808, 4265, 4624, 5570
PsuI RGATCY 5 cut(s) 3008, 3058, 3716, 4360, 5914
PsyI GACNNNGTC 1 cut(s) 6268
PvuI CGATCG 3 cut(s) 8, 212, 461
PvuII CAGCTG 1 cut(s) 4493
RsaI GTAC 7 cut(s) 1506, 2146, 2186, 2375, 3634, 3677, 4884
RsaNI GTAC 7 cut(s) 1505, 2145, 2185, 2374, 3633, 3676, 4883
RseI CAYNNNNRTG 6 cut(s) 3468, 3627, 4054, 5094, 5586, 6007
SacI GAGCTC 3 cut(s) 167, 371, 620
SapI GCTCTTC 2 cut(s) 1804, 3379
ScaI AGTACT 1 cut(s) 2186
SchI GAGTC 7 cut(s) 1566, 1948, 2384, 2682, 3164, 4151, 5387
SfcI CTRYAG 4 cut(s) 1377, 3062, 4686, 5616
Sfr274I CTCGAG 1 cut(s) 2838
SfuI TTCGAA 1 cut(s) 2229
SinI GGWCC 7 cut(s) 131, 335, 584, 1877, 3459, 4679, 4700
SlaI CTCGAG 1 cut(s) 2838
SmaI CCCGGG 5 cut(s) 136, 340, 411, 589, 660
SmiMI CAYNNNNRTG 6 cut(s) 3468, 3627, 4054, 5094, 5586, 6007
SmlI CTYRAG 5 cut(s) 2838, 3017, 3078, 4895, 5692
SmoI CTYRAG 5 cut(s) 2838, 3017, 3078, 4895, 5692
SphI GCATGC 1 cut(s) 3527
SseBI AGGCCT 1 cut(s) 4815
SspI AATATT 3 cut(s) 2730, 3846, 4780
SstI GAGCTC 3 cut(s) 167, 371, 620
StuI AGGCCT 1 cut(s) 4815
StyI CCWWGG 2 cut(s) 1395, 4703
TaiI ACGT 5 cut(s) 1870, 2329, 2605, 3677, 5625
TaqII GACCGA 1 cut(s) 4245
TatI WGTACW 3 cut(s) 2144, 2184, 2373
TauI GCSGC 4 cut(s) 418, 667, 1991, 2905
TseFI GTSAC 4 cut(s) 1683, 4235, 4968, 6270
TseI GCWGC 7 cut(s) 1367, 3083, 3134, 3260, 3389, 5192, 5505
Tsp45I GTSAC 4 cut(s) 1683, 4235, 4968, 6270
TspGWI ACGGA 4 cut(s) 3001, 3606, 3831, 4900
TspMI CCCGGG 5 cut(s) 134, 338, 409, 587, 658
Tth111I GACNNNGTC 1 cut(s) 6268
Van91I CCANNNNNTGG 2 cut(s) 3005, 4324
Vha464I CTTAAG 1 cut(s) 3017
VneI GTGCAC 3 cut(s) 1342, 2094, 2598
VpaK11BI GGWCC 7 cut(s) 131, 335, 584, 1877, 3459, 4679, 4700
VspI ATTAAT 1 cut(s) 2585
XagI CCTNNNNNAGG 3 cut(s) 2526, 2556, 3427
XceI RCATGY 6 cut(s) 1669, 2598, 3222, 3527, 4115, 6030
XhoI CTCGAG 1 cut(s) 2838
XmaI CCCGGG 5 cut(s) 134, 338, 409, 587, 658
XmiI GTMKAC 1 cut(s) 5578
XmnI GAANNNNTTC 1 cut(s) 2162
ZraI GACGTC 2 cut(s) 1868, 5623
ZrmI AGTACT 1 cut(s) 2186
Zsp2I ATGCAT 1 cut(s) 6189
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.