Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0002387.1

Orthogroup ID

OG0005221

Physical Location & Seq

Genomic Coordinates Forward (+)

26973 .. 27704

Gene Structure 732 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0002387.1_g000009.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 732 bp

atgtctattattggtttaattttctgcgtttttgtggatgaattaaatttgaaggtaccatacttgagggaatgggacctgcaagtgctggatgtaatgtgtgatagttttgaaccagtaatctatacagaggagagttgcatttttcgggagaaggaacctgtggacgtgatggtcttcatagtgcatggcaggctgttgagtgtgaccatgaatggtgaaacaactgggtcactctccaactctccatatctcaaggtcggtgacgtctgcgggttagagatcctcatttgggctcttgatgttcactcgtcatctgatcatcttcccatatcgaccagcactatccaacctctcagtaaagttttaggcctcgttctaaacgcaaaggacttgaagttgataggctctcaatttcggcaactacagctccaccataaaatcagattttactcacaacagtggaggacttgggcagcttatactatacaagcagcgtggcaccgttactggatgcttaagcgtaaggaggctctggcggaaaaggagaatgaaaggttgcaaaatgcattgaaggctggtcctagcaccccaagtctaggtgccaccatatatgcctcacacttcgctgctaatgtgcttcgtcctatacggagtaatgttacacatagggcaagggtgccagagagaagaaggctaaagcgatttcagaaaccaagttacttggtttaa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0005575 GO:0005623 GO:0005886 GO:0005887 GO:0008150 GO:0016020 GO:0016021 GO:0031224 GO:0031226 GO:0042391 GO:0044425 GO:0044459 GO:0044464 GO:0065007 GO:0065008 GO:0071944

KEGG Pathways

Metabolic & Signaling

ko04626 map04626

Pfam Domains

Protein Families

Ion_trans cNMP_binding

Protein Analysis

243

Amino Acids

27.92

Weight (kDa)

9.28

Isoelectric Point (pI)

41.94

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0005221)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT5G53130
fragaria_vesca	FvH4_2g31110 FvH4_7g31200 FvH4_7g31200 FvH4_7g31200 FvH4_7g31200
malus_domestica	MD01G1217100.v1.1 MD01G1217300.v1.1 MD07G1286700.v1.1
prunus_persica	Prupe.2G308700_v2.0.a1 Prupe.2G308700_v2.0.a1 Prupe.2G308700_v2.0.a1
pyrus_communis	pycom01g22750 pycom07g26000
rosa_chinensis	RchiOBHm_Chr1g0380261 RchiOBHm_Chr1g0380301
rosa_laevigata	RLG00000026314
rosa_multiflora	Rmu_sc0001232.1_g000031 Rmu_sc0002387.1_g000001 Rmu_sc0002387.1_g000009 Rmu_sc0003249.1_g000001
rosa_roxburghii	Rroxscaffold_4G00279530
rosa_rugosa	Rorug01G0419600 Rorug01G0419700
rosa_samantha	Rh1AG444200 Rh1AG444300 Rh1CG412900
rosa_wichuraiana	Rw1G038580 Rw1G038650

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AasI	GACNNNNNNGTC	1 cut(s)	173
AatII	GACGTC	1 cut(s)	270
Acc36I	ACCTGC	1 cut(s)	87
Acc65I	GGTACC	1 cut(s)	55
AccB1I	GGYRCC	4 cut(s)	55, 501, 602, 679
AciI	CCGC	2 cut(s)	273, 539
AclWI	GGATC	1 cut(s)	277
AcsI	RAATTY	1 cut(s)	46
AcyI	GRCGYC	1 cut(s)	267
AfaI	GTAC	1 cut(s)	57
AfiI	CCNNNNNNNGG	2 cut(s)	292, 599
AflII	CTTAAG	1 cut(s)	518
AgsI	TTSAA	4 cut(s)	52, 113, 397, 574
AjiI	CACGTC	1 cut(s)	169
AleI	CACNNNNGTG	1 cut(s)	460
AluBI	AGCT	2 cut(s)	430, 479
AluI	AGCT	2 cut(s)	430, 479
AlwI	GGATC	1 cut(s)	277
AoxI	GGCC	1 cut(s)	370
ApeKI	GCWGC	3 cut(s)	476, 494, 629
ApoI	RAATTY	1 cut(s)	46
Asp718I	GGTACC	1 cut(s)	55
AspS9I	GGNCC	2 cut(s)	76, 581
AsuHPI	GGTGA	2 cut(s)	230, 275
AvaII	GGWCC	2 cut(s)	76, 581
BanI	GGYRCC	4 cut(s)	55, 501, 602, 679
BanII	GRGCYC	1 cut(s)	298
BarI	GAAGNNNNNNTAC	2 cut(s)	44, 76
BbsI	GAAGAC	1 cut(s)	169
BbvI	GCAGC	3 cut(s)	488, 506, 616
BccI	CCATC	1 cut(s)	166
BclI	TGATCA	1 cut(s)	319
BfaI	CTAG	2 cut(s)	585, 599
BfmI	CTRYAG	1 cut(s)	425
BfrI	CTTAAG	1 cut(s)	518
BfuAI	ACCTGC	1 cut(s)	87
BisI	GCNGC	3 cut(s)	477, 495, 630
BlsI	GCNGC	3 cut(s)	478, 496, 631
Bme18I	GGWCC	2 cut(s)	76, 581
BmgBI	CACGTC	1 cut(s)	169
BmgT120I	GGNCC	2 cut(s)	76, 581
BmiI	GGNNCC	6 cut(s)	57, 77, 159, 503, 604, 681
BmrI	ACTGGG	1 cut(s)	237
BmsI	GCATC	1 cut(s)	504
BmuI	ACTGGG	1 cut(s)	237
BpiI	GAAGAC	1 cut(s)	169
BpuEI	CTTGAG	2 cut(s)	85, 239
BsaHI	GRCGYC	1 cut(s)	267
BsaXI	ACNNNNNCTCC	2 cut(s)	414, 444
Bsc4I	CCNNNNNNNGG	2 cut(s)	292, 599
Bse1I	ACTGG	3 cut(s)	116, 232, 515
BseGI	GGATG	3 cut(s)	43, 97, 519
BseLI	CCNNNNNNNGG	2 cut(s)	292, 599
BseMII	CTCAG	1 cut(s)	370
BseNI	ACTGG	3 cut(s)	116, 232, 515
BseRI	GAGGAG	1 cut(s)	146
BseXI	GCAGC	3 cut(s)	488, 506, 616
BshFI	GGCC	1 cut(s)	372
BshNI	GGYRCC	4 cut(s)	55, 501, 602, 679
BslFI	GGGAC	1 cut(s)	89
BslI	CCNNNNNNNGG	2 cut(s)	292, 599
BsmFI	GGGAC	1 cut(s)	89
BsnI	GGCC	1 cut(s)	372
Bsp1286I	GDGCHC	1 cut(s)	298
Bsp143I	GATC	2 cut(s)	282, 319
BspACI	CCGC	2 cut(s)	273, 539
BspANI	GGCC	1 cut(s)	372
BspCNI	CTCAG	1 cut(s)	369
BspLI	GGNNCC	6 cut(s)	57, 77, 159, 503, 604, 681
BspMI	ACCTGC	1 cut(s)	87
BspPI	GGATC	1 cut(s)	277
BspT107I	GGYRCC	4 cut(s)	55, 501, 602, 679
BspTI	CTTAAG	1 cut(s)	518
BsrI	ACTGG	3 cut(s)	116, 232, 515
BssMI	GATC	2 cut(s)	282, 319
BssNI	GRCGYC	1 cut(s)	267
Bst4CI	ACNGT	2 cut(s)	462, 506
BstACI	GRCGYC	1 cut(s)	267
BstAFI	CTTAAG	1 cut(s)	518
BstC8I	GCNNGC	1 cut(s)	194
BstDEI	CTNAG	1 cut(s)	356
BstF5I	GGATG	3 cut(s)	43, 97, 519
BstKTI	GATC	2 cut(s)	285, 322
BstMBI	GATC	2 cut(s)	282, 319
BstMWI	GCNNNNNNNGC	3 cut(s)	193, 427, 575
BstSFI	CTRYAG	1 cut(s)	425
BstV1I	GCAGC	3 cut(s)	488, 506, 616
BstV2I	GAAGAC	1 cut(s)	169
BstX2I	RGATCY	1 cut(s)	282
BstYI	RGATCY	1 cut(s)	282
BsuRI	GGCC	1 cut(s)	372
BtrI	CACGTC	1 cut(s)	169
BtsCI	GGATG	3 cut(s)	43, 97, 519
BtsIMutI	CAGTG	1 cut(s)	467
BveI	ACCTGC	1 cut(s)	87
Cac8I	GCNNGC	1 cut(s)	194
Cfr13I	GGNCC	2 cut(s)	76, 581
Csp6I	GTAC	1 cut(s)	56
CspCI	CAANNNNNGTGG	2 cut(s)	479, 514
CviAII	CATG	2 cut(s)	188, 211
CviJI	RGCY	9 cut(s)	196, 296, 372, 408, 430, 479, 533, 578, 697
CviKI_1	RGCY	9 cut(s)	196, 296, 372, 408, 430, 479, 533, 578, 697
CviQI	GTAC	1 cut(s)	56
DdeI	CTNAG	1 cut(s)	356
DpnI	GATC	2 cut(s)	284, 321
DpnII	GATC	2 cut(s)	282, 319
DrdI	GACNNNNNNGTC	1 cut(s)	173
DseDI	GACNNNNNNGTC	1 cut(s)	173
EciI	GGCGGA	1 cut(s)	554
Eco147I	AGGCCT	1 cut(s)	372
Eco24I	GRGCYC	1 cut(s)	298
Eco47I	GGWCC	2 cut(s)	76, 581
EcoO109I	RGGNCCY	1 cut(s)	76
EcoT22I	ATGCAT	1 cut(s)	571
EcoT38I	GRGCYC	1 cut(s)	298
FaeI	CATG	2 cut(s)	191, 214
FaqI	GGGAC	1 cut(s)	89
FatI	CATG	2 cut(s)	187, 210
FauI	CCCGC	1 cut(s)	266
FbaI	TGATCA	1 cut(s)	319
Fnu4HI	GCNGC	3 cut(s)	477, 495, 630
FokI	GGATG	3 cut(s)	50, 104, 526
FriOI	GRGCYC	1 cut(s)	298
Fsp4HI	GCNGC	3 cut(s)	477, 495, 630
FspBI	CTAG	2 cut(s)	585, 599
GluI	GCNGC	3 cut(s)	477, 495, 630
HaeIII	GGCC	1 cut(s)	372
Hin1I	GRCGYC	1 cut(s)	267
Hin1II	CATG	2 cut(s)	191, 214
HphI	GGTGA	2 cut(s)	230, 275
Hpy166II	GTNNAC	2 cut(s)	166, 307
Hpy188I	TCNGA	3 cut(s)	319, 446, 711
Hpy188III	TCNNGA	2 cut(s)	149, 299
Hpy8I	GTNNAC	2 cut(s)	166, 307
HpyAV	CCTTC	4 cut(s)	46, 148, 568, 687
HpyCH4III	ACNGT	2 cut(s)	462, 506
HpyCH4IV	ACGT	2 cut(s)	168, 267
HpyCH4V	TGCA	5 cut(s)	82, 141, 187, 562, 569
HpyF10VI	GCNNNNNNNGC	3 cut(s)	193, 427, 575
HpyF3I	CTNAG	1 cut(s)	356
HpySE526I	ACGT	2 cut(s)	168, 267
Hsp92I	GRCGYC	1 cut(s)	267
Hsp92II	CATG	2 cut(s)	191, 214
KpnI	GGTACC	1 cut(s)	59
Ksp22I	TGATCA	1 cut(s)	319
Kzo9I	GATC	2 cut(s)	282, 319
LmnI	GCTCC	1 cut(s)	435
Lsp1109I	GCAGC	3 cut(s)	488, 506, 616
LweI	GCATC	1 cut(s)	504
MaeI	CTAG	2 cut(s)	585, 599
MaeII	ACGT	2 cut(s)	168, 267
MaeIII	GTNAC	6 cut(s)	205, 231, 263, 506, 661, 719
MalI	GATC	2 cut(s)	284, 321
MboI	GATC	2 cut(s)	282, 319
MboII	GAAGA	3 cut(s)	169, 317, 702
MflI	RGATCY	1 cut(s)	282
MhlI	GDGCHC	1 cut(s)	298
MluCI	AATT	4 cut(s)	18, 41, 46, 413
MmeI	TCCRAC	2 cut(s)	264, 373
MnlI	CCTC	8 cut(s)	60, 124, 296, 363, 383, 459, 523, 628
Mph1103I	ATGCAT	1 cut(s)	571
MseI	TTAA	4 cut(s)	17, 44, 519, 730
MslI	CAYNNNNRTG	1 cut(s)	460
MspCI	CTTAAG	1 cut(s)	518
MwoI	GCNNNNNNNGC	3 cut(s)	193, 427, 575
NdeII	GATC	2 cut(s)	282, 319
NlaIII	CATG	2 cut(s)	191, 214
NlaIV	GGNNCC	6 cut(s)	57, 77, 159, 503, 604, 681
NmuCI	GTSAC	3 cut(s)	205, 231, 263
NsiI	ATGCAT	1 cut(s)	571
OliI	CACNNNNGTG	1 cut(s)	460
PceI	AGGCCT	1 cut(s)	372
PkrI	GCNGC	3 cut(s)	478, 496, 631
PpuMI	RGGWCCY	1 cut(s)	76
Psp5II	RGGWCCY	1 cut(s)	76
PspN4I	GGNNCC	6 cut(s)	57, 77, 159, 503, 604, 681
PspPI	GGNCC	2 cut(s)	76, 581
PspPPI	RGGWCCY	1 cut(s)	76
PsuI	RGATCY	1 cut(s)	282
RsaI	GTAC	1 cut(s)	57
RsaNI	GTAC	1 cut(s)	56
RseI	CAYNNNNRTG	1 cut(s)	460
SaqAI	TTAA	4 cut(s)	17, 44, 519, 730
SatI	GCNGC	3 cut(s)	477, 495, 630
Sau3AI	GATC	2 cut(s)	282, 319
Sau96I	GGNCC	2 cut(s)	76, 581
SduI	GDGCHC	1 cut(s)	298
SfaNI	GCATC	1 cut(s)	504
SfcI	CTRYAG	1 cut(s)	425
SinI	GGWCC	2 cut(s)	76, 581
SmiMI	CAYNNNNRTG	1 cut(s)	460
SmlI	CTYRAG	3 cut(s)	64, 254, 518
SmoI	CTYRAG	3 cut(s)	64, 254, 518
Sse9I	AATT	4 cut(s)	18, 41, 46, 413
SseBI	AGGCCT	1 cut(s)	372
SsiI	CCGC	2 cut(s)	273, 539
SspMI	CTAG	2 cut(s)	585, 599
StuI	AGGCCT	1 cut(s)	372
TaaI	ACNGT	2 cut(s)	462, 506
TaiI	ACGT	2 cut(s)	171, 270
TaqI	TCGA	1 cut(s)	335
TasI	AATT	4 cut(s)	18, 41, 46, 413
Tru1I	TTAA	4 cut(s)	17, 44, 519, 730
Tru9I	TTAA	4 cut(s)	17, 44, 519, 730
TscAI	CASTG	1 cut(s)	467
TseFI	GTSAC	3 cut(s)	205, 231, 263
TseI	GCWGC	3 cut(s)	476, 494, 629
Tsp45I	GTSAC	3 cut(s)	205, 231, 263
TspDTI	ATGAA	4 cut(s)	54, 169, 227, 567
TspGWI	ACGGA	1 cut(s)	667
TspRI	CASTG	1 cut(s)	467
Vha464I	CTTAAG	1 cut(s)	518
VpaK11BI	GGWCC	2 cut(s)	76, 581
XapI	RAATTY	1 cut(s)	46
XspI	CTAG	2 cut(s)	585, 599
ZraI	GACGTC	1 cut(s)	268
Zsp2I	ATGCAT	1 cut(s)	571

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.