Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0002400.1

Orthogroup ID

OG0006947

Physical Location & Seq

Genomic Coordinates Reverse (-)

1 .. 1455

Gene Structure 1455 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0002400.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 617 bp

atgacaggcttggttgaggatggagttccttcaggaaacctctctgggaggcatcactttgacattgatgtaaaggatgaggaagtgaatgacaaccctgttgagcaagtgaggttaactgtttcaaccaccgatgacccttctcaaccaaccttgacatttcggacatgggttcttggcctactctcatgctccattcttgcctttgtcaaccagttttttggttatcgcaccaaccagctctatgtgtcatcagtctcggcacaaattcttgtcctccctctggggaagttgatggctgcaaccctcccaacttatcaattacgagtcccctttacaaaatggaaattttcaatgaatccggggcctttcaatctgaaagaacatgtgctgatcaccatatttgccaactctggatcaaacagtgtctatgctgtgaacatcatcacaattgttctggctttttacaaaaggaaactgcatcctgcatcagccttcttgttagcacaaaccacacagatgcttgggtatggatgggctggcctattcagaagataccttgttgactctccttacatgtggtggccgtcaaatctggttcaagtctctctattcag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0005215 GO:0005575 GO:0005623 GO:0005886 GO:0005887 GO:0006810 GO:0006857 GO:0008150 GO:0015833 GO:0016020 GO:0016021 GO:0022857 GO:0031224 GO:0031226 GO:0035672 GO:0035673 GO:0042886 GO:0042887 GO:0044425 GO:0044459 GO:0044464 GO:0051179 GO:0051234 GO:0055085 GO:0071702 GO:0071705 GO:0071944 GO:1904680

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

OPT

Protein Analysis

205

Amino Acids

23.06

Weight (kDa)

8.69

Isoelectric Point (pI)

36.0

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0006947)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_6g48400 FvH4_6g48400 FvH4_6g48400 FvH4_6g48400 FvH4_6g48400 FvH4_6g48400 FvH4_6g48400 FvH4_6g48400 FvH4_6g48400 FvH4_6g48400
malus_domestica	MD10G1056600.v1.1
prunus_persica	Prupe.5G128100_v2.0.a1
pyrus_communis	pycom10g04350
rosa_chinensis	RchiOBHm_Chr1g0381911 RchiOBHm_Chr2g0161591
rosa_laevigata	RLG00000004821
rosa_multiflora	Rmu_co7963376.1_g000001 Rmu_co8294873.1_g000001 Rmu_co8426875.1_g000001 Rmu_co8431857.1_g000001 Rmu_sc0001742.1_g000002 Rmu_sc0002400.1_g000001 Rmu_sc0008051.1_g000001
rosa_samantha	Rh1BG412500 Rh1CG427300 Rh1DG444800

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AclWI	GGATC	1 cut(s)	424
AcoI	YGGCCR	1 cut(s)	584
AcsI	RAATTY	2 cut(s)	267, 347
AcuI	CTGAAG	1 cut(s)	15
AfiI	CCNNNNNNNGG	1 cut(s)	283
AflIII	ACRYGT	2 cut(s)	385, 576
AgsI	TTSAA	4 cut(s)	126, 354, 373, 602
AluBI	AGCT	1 cut(s)	241
AluI	AGCT	1 cut(s)	241
Alw26I	GTCTC	2 cut(s)	262, 610
AlwI	GGATC	1 cut(s)	424
AoxI	GGCC	4 cut(s)	178, 365, 541, 584
ApeKI	GCWGC	1 cut(s)	299
ApoI	RAATTY	2 cut(s)	267, 347
AspS9I	GGNCC	1 cut(s)	365
AsuC2I	CCSGG	1 cut(s)	363
AsuHPI	GGTGA	1 cut(s)	388
BbvI	GCAGC	1 cut(s)	286
BccI	CCATC	3 cut(s)	14, 289, 528
BceAI	ACGGC	1 cut(s)	571
BclI	TGATCA	1 cut(s)	393
BcnI	CCSGG	1 cut(s)	363
BcoDI	GTCTC	2 cut(s)	262, 610
BisI	GCNGC	1 cut(s)	300
BlsI	GCNGC	1 cut(s)	301
Bme1390I	CCNGG	1 cut(s)	363
BmgT120I	GGNCC	1 cut(s)	365
BmiI	GGNNCC	1 cut(s)	366
BmrFI	CCNGG	1 cut(s)	363
BmsI	GCATC	4 cut(s)	61, 490, 497, 510
BpuMI	CCSGG	1 cut(s)	363
BsaJI	CCNNGG	1 cut(s)	362
Bsc4I	CCNNNNNNNGG	1 cut(s)	283
Bse1I	ACTGG	1 cut(s)	214
BseDI	CCNNGG	1 cut(s)	362
BseGI	GGATG	4 cut(s)	25, 82, 481, 539
BseLI	CCNNNNNNNGG	1 cut(s)	283
BseNI	ACTGG	1 cut(s)	214
BseXI	GCAGC	1 cut(s)	286
BshFI	GGCC	4 cut(s)	180, 367, 543, 586
BsiSI	CCGG	1 cut(s)	362
BslFI	GGGAC	1 cut(s)	314
BslI	CCNNNNNNNGG	1 cut(s)	283
BsmAI	GTCTC	2 cut(s)	262, 610
BsmFI	GGGAC	1 cut(s)	314
BsnI	GGCC	4 cut(s)	180, 367, 543, 586
Bsp143I	GATC	2 cut(s)	393, 416
BspANI	GGCC	4 cut(s)	180, 367, 543, 586
BspLI	GGNNCC	1 cut(s)	366
BspPI	GGATC	1 cut(s)	424
BsrI	ACTGG	1 cut(s)	214
BssECI	CCNNGG	1 cut(s)	362
BssMI	GATC	2 cut(s)	393, 416
Bst4CI	ACNGT	2 cut(s)	121, 425
BstC8I	GCNNGC	1 cut(s)	541
BstF5I	GGATG	4 cut(s)	25, 82, 481, 539
BstKTI	GATC	2 cut(s)	396, 419
BstMAI	GTCTC	2 cut(s)	262, 610
BstMBI	GATC	2 cut(s)	393, 416
BstNSI	RCATGY	2 cut(s)	389, 580
BstSCI	CCNGG	1 cut(s)	361
BstV1I	GCAGC	1 cut(s)	286
BstXI	CCANNNNNNTGG	1 cut(s)	221
BsuRI	GGCC	4 cut(s)	180, 367, 543, 586
BtsCI	GGATG	4 cut(s)	25, 82, 481, 539
BtsIMutI	CAGTG	1 cut(s)	430
Cac8I	GCNNGC	1 cut(s)	541
Cfr13I	GGNCC	1 cut(s)	365
CviAII	CATG	4 cut(s)	168, 189, 386, 577
DpnI	GATC	2 cut(s)	395, 418
DpnII	GATC	2 cut(s)	393, 416
EaeI	YGGCCR	1 cut(s)	584
Eco57I	CTGAAG	1 cut(s)	15
EcoO109I	RGGNCCY	1 cut(s)	365
FaeI	CATG	4 cut(s)	171, 192, 389, 580
FaiI	YATR	8 cut(s)	169, 190, 246, 387, 401, 432, 531, 578
FaqI	GGGAC	1 cut(s)	314
FatI	CATG	4 cut(s)	167, 188, 385, 576
FbaI	TGATCA	1 cut(s)	393
Fnu4HI	GCNGC	1 cut(s)	300
FokI	GGATG	4 cut(s)	32, 89, 468, 546
Fsp4HI	GCNGC	1 cut(s)	300
GluI	GCNGC	1 cut(s)	300
HaeIII	GGCC	4 cut(s)	180, 367, 543, 586
HapII	CCGG	1 cut(s)	362
Hin1II	CATG	4 cut(s)	171, 192, 389, 580
HincII	GTYRAC	3 cut(s)	117, 211, 565
HindII	GTYRAC	3 cut(s)	117, 211, 565
HinfI	GANTC	3 cut(s)	327, 358, 566
HpaI	GTTAAC	1 cut(s)	117
HpaII	CCGG	1 cut(s)	362
HphI	GGTGA	1 cut(s)	388
Hpy166II	GTNNAC	4 cut(s)	117, 211, 439, 565
Hpy188I	TCNGA	3 cut(s)	165, 378, 551
Hpy188III	TCNNGA	2 cut(s)	33, 414
Hpy8I	GTNNAC	4 cut(s)	117, 211, 439, 565
HpyAV	CCTTC	3 cut(s)	39, 150, 505
HpyCH4III	ACNGT	2 cut(s)	121, 425
HpyCH4V	TGCA	3 cut(s)	302, 481, 488
Hsp92II	CATG	4 cut(s)	171, 192, 389, 580
Ksp22I	TGATCA	1 cut(s)	393
KspAI	GTTAAC	1 cut(s)	117
Kzo9I	GATC	2 cut(s)	393, 416
LmnI	GCTCC	1 cut(s)	197
Lsp1109I	GCAGC	1 cut(s)	286
LweI	GCATC	4 cut(s)	61, 490, 497, 510
MalI	GATC	2 cut(s)	395, 418
MboI	GATC	2 cut(s)	393, 416
MboII	GAAGA	1 cut(s)	564
MfeI	CAATTG	1 cut(s)	450
MluCI	AATT	4 cut(s)	267, 320, 347, 450
MlyI	GAGTC	2 cut(s)	336, 560
MnlI	CCTC	8 cut(s)	10, 42, 50, 73, 105, 287, 291, 317
MseI	TTAA	1 cut(s)	116
MslI	CAYNNNNRTG	1 cut(s)	518
MspI	CCGG	1 cut(s)	362
MspR9I	CCNGG	1 cut(s)	363
MunI	CAATTG	1 cut(s)	450
NciI	CCSGG	1 cut(s)	363
NdeII	GATC	2 cut(s)	393, 416
NlaIII	CATG	4 cut(s)	171, 192, 389, 580
NlaIV	GGNNCC	1 cut(s)	366
NmeAIII	GCCGAG	1 cut(s)	239
NspI	RCATGY	2 cut(s)	389, 580
PciI	ACATGT	2 cut(s)	385, 576
PfeI	GAWTC	1 cut(s)	358
PkrI	GCNGC	1 cut(s)	301
PleI	GAGTC	2 cut(s)	335, 560
PpsI	GAGTC	2 cut(s)	335, 560
PscI	ACATGT	2 cut(s)	385, 576
PspN4I	GGNNCC	1 cut(s)	366
PspPI	GGNCC	1 cut(s)	365
RseI	CAYNNNNRTG	1 cut(s)	518
SaqAI	TTAA	1 cut(s)	116
SatI	GCNGC	1 cut(s)	300
Sau3AI	GATC	2 cut(s)	393, 416
Sau96I	GGNCC	1 cut(s)	365
SchI	GAGTC	2 cut(s)	336, 560
ScrFI	CCNGG	1 cut(s)	363
SetI	ASST	5 cut(s)	42, 116, 155, 243, 561
SfaNI	GCATC	4 cut(s)	61, 490, 497, 510
SmiMI	CAYNNNNRTG	1 cut(s)	518
Sse9I	AATT	4 cut(s)	267, 320, 347, 450
StyD4I	CCNGG	1 cut(s)	361
TaaI	ACNGT	2 cut(s)	121, 425
TasI	AATT	4 cut(s)	267, 320, 347, 450
TfiI	GAWTC	1 cut(s)	358
Tru1I	TTAA	1 cut(s)	116
Tru9I	TTAA	1 cut(s)	116
TscAI	CASTG	1 cut(s)	430
TseI	GCWGC	1 cut(s)	299
TspDTI	ATGAA	1 cut(s)	371
TspRI	CASTG	1 cut(s)	430
XapI	RAATTY	2 cut(s)	267, 347
XceI	RCATGY	2 cut(s)	389, 580

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.