Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0002579.1

Orthogroup ID

OG0002994

Physical Location & Seq

Genomic Coordinates Reverse (-)

1 .. 3327

Gene Structure 3327 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0002579.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 1225 bp

atgggaagaatttatggggtgcatttggtggtgttaattgttttggggatggttgtgagctcttggtgtcaggatgatgatgattatgataacatctctgctgtgtatattgtcactcttaaacaagctcctgttgctcattacttggctgacctgagaaagaacagtcaaggtttgaatggggatactgaaaggttgagcattcacaaaccaagatctataaatatttcaaggacggatcctaagtatgcctcatacattgctcgagttcatgattcattattgaggagggcgttgaaaggggagaaatatctgaagctgtacagctaccactacttgattaatgggtttgctgtgcttgttaccccggatcaggttaataagctttccaggaggagagaagtagcaaatgtggtcctagatttctctgttagaactgcaacaacccatactcctcagttcttgggtttaccacaaggagcatgggtccaaggaggtggatttaaatcagccggagaaggggttgtgattggatttattgatactggcattgatccaacacacagtagttttgctgataattcatctaaaaatccatatccagttccagctcatttctcaggcgtctgtgaggttactcgagattttccatctggttcatgcaataggaagcttatagcggcccgccattttgcagcatctgctataaccaggggtgttttcaatatatcccaggactatgcttctccttttgatggtgatggccacggcacgcacactgcttccattgctgcaggaaaccatggaattccagtggttgttgctgggcatcattttggacatgcaagtgggatggctcctcgatcacacattgctgtttacaaggcattgtacaaaagctttggaggctttgctgctgatgttgttgccgcaatagaccaggctgctcaggatggggttgacattataagcttatcaatcactcccaatagacgtcctcccggagttgcaacatttttcaaccccatagatatggcaacactatcagccgtaaaggttggtatatttgttgtccaagcagcaggaaatactggaccatcaccaaaaagcatgtcttccttcagtccatggatcttcactgttggttctgcttctcatgacagaacctacagcaactctataacccttggcaacaatgtgaccattcctggagttggacttgcac

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003824 GO:0004175 GO:0004252 GO:0006508 GO:0006807 GO:0008150 GO:0008152 GO:0008233 GO:0008236 GO:0016787 GO:0017171 GO:0019538 GO:0043170 GO:0044238 GO:0070011 GO:0071704 GO:0140096 GO:1901564

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Inhibitor_I9 Peptidase_S8

Protein Analysis

408

Amino Acids

43.62

Weight (kDa)

9.1

Isoelectric Point (pI)

36.57

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0002994)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G30600 AT4G20430 AT4G20430 AT4G20430 AT5G44530 AT5G44530 AT5G44530
fragaria_vesca	FvH4_3g11550 FvH4_3g11550 FvH4_3g11550 FvH4_3g11550 FvH4_3g11550 FvH4_3g11550
malus_domestica	MD00G1096900.v1.1 MD10G1240800.v1.1
prunus_persica	Prupe.4G102800_v2.0.a1 Prupe.4G102800_v2.0.a1 Prupe.4G102800_v2.0.a1 Prupe.4G102800_v2.0.a1 Prupe.4G102800_v2.0.a1 Prupe.4G102800_v2.0.a1 Prupe.4G102800_v2.0.a1
pyrus_communis	pycom05g24650 pycom05g24660 pycom10g20150
rosa_chinensis	RchiOBHm_Chr5g0018491
rosa_laevigata	RLG00000032371
rosa_multiflora	Rmu_sc0002579.1_g000001 Rmu_sc0004464.1_g000018 Rmu_sc0038967.1_g000001
rosa_roxburghii	Rroxscaffold_1G00059240
rosa_rugosa	Rorug05G0044600 Rorug05G0044700
rosa_samantha	Rh5AG135800 Rh5BG134700 Rh5CG146800 Rh5DG135900
rosa_wichuraiana	Rw5G012030

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AanI	TTATAA	1 cut(s)	968
AatII	GACGTC	1 cut(s)	997
AciI	CCGC	3 cut(s)	680, 685, 930
AclWI	GGATC	5 cut(s)	233, 246, 378, 548, 1139
AcoI	YGGCCR	1 cut(s)	763
AcsI	RAATTY	2 cut(s)	9, 807
AcuI	CTGAAG	2 cut(s)	335, 1105
AcyI	GRCGYC	2 cut(s)	624, 994
AfaI	GTAC	2 cut(s)	323, 893
AfiI	CCNNNNNNNGG	4 cut(s)	373, 519, 755, 1214
AgsI	TTSAA	5 cut(s)	178, 231, 298, 724, 1021
AjnI	CCWGG	5 cut(s)	389, 710, 732, 939, 1207
AluBI	AGCT	9 cut(s)	60, 128, 319, 327, 385, 611, 673, 900, 972
AluI	AGCT	9 cut(s)	60, 128, 319, 327, 385, 611, 673, 900, 972
Alw21I	GWGCWC	1 cut(s)	62
AlwI	GGATC	5 cut(s)	233, 246, 378, 548, 1139
AlwNI	CAGNNNCTG	1 cut(s)	701
Ama87I	CYCGRG	2 cut(s)	264, 639
AoxI	GGCC	2 cut(s)	681, 763
ApeKI	GCWGC	5 cut(s)	695, 791, 914, 944, 1079
ApoI	RAATTY	2 cut(s)	9, 807
ArsI	GACNNNNNNTTYG	2 cut(s)	1097, 1129
AseI	ATTAAT	1 cut(s)	342
AspS9I	GGNCC	4 cut(s)	415, 487, 682, 1094
AsuC2I	CCSGG	2 cut(s)	368, 1002
AsuHPI	GGTGA	2 cut(s)	770, 1092
AvaI	CYCGRG	2 cut(s)	264, 639
AvaII	GGWCC	3 cut(s)	415, 487, 1094
BalI	TGGCCA	1 cut(s)	765
BamHI	GGATCC	1 cut(s)	238
BanII	GRGCYC	1 cut(s)	62
BbsI	GAAGAC	1 cut(s)	1107
Bbv12I	GWGCWC	1 cut(s)	62
BbvI	GCAGC	5 cut(s)	707, 778, 901, 931, 1091
BccI	CCATC	7 cut(s)	43, 658, 749, 755, 847, 947, 1105
BceAI	ACGGC	2 cut(s)	784, 1034
BciT130I	CCWGG	5 cut(s)	391, 712, 734, 941, 1209
BciVI	GTATCC	1 cut(s)	178
BcnI	CCSGG	2 cut(s)	368, 1002
BfaI	CTAG	1 cut(s)	419
BfmI	CTRYAG	2 cut(s)	792, 1168
BfuI	GTATCC	1 cut(s)	178
BglII	AGATCT	1 cut(s)	215
BisI	GCNGC	7 cut(s)	681, 696, 792, 915, 930, 945, 1080
BlsI	GCNGC	7 cut(s)	682, 697, 793, 916, 931, 946, 1081
Bme1390I	CCNGG	7 cut(s)	368, 391, 712, 734, 941, 1002, 1209
Bme18I	GGWCC	3 cut(s)	415, 487, 1094
BmeT110I	CYCGRG	2 cut(s)	264, 639
BmgT120I	GGNCC	4 cut(s)	415, 487, 682, 1094
BmiI	GGNNCC	3 cut(s)	240, 488, 858
BmrFI	CCNGG	7 cut(s)	368, 391, 712, 734, 941, 1002, 1209
BmsI	GCATC	2 cut(s)	707, 838
BpiI	GAAGAC	1 cut(s)	1107
Bpu10I	CCTNAGC	1 cut(s)	948
BpuMI	CCSGG	2 cut(s)	368, 1002
BsaBI	GATNNNNATC	1 cut(s)	505
BsaHI	GRCGYC	2 cut(s)	624, 994
BsaJI	CCNNGG	8 cut(s)	366, 490, 711, 732, 766, 802, 1127, 1186
BsaXI	ACNNNNNCTCC	6 cut(s)	436, 466, 471, 501, 507, 537
Bsc4I	CCNNNNNNNGG	4 cut(s)	373, 519, 755, 1214
Bse1I	ACTGG	4 cut(s)	550, 602, 812, 1096
Bse3DI	GCAATG	3 cut(s)	258, 786, 870
Bse8I	GATNNNNATC	1 cut(s)	505
BseBI	CCWGG	5 cut(s)	391, 712, 734, 941, 1209
BseDI	CCNNGG	8 cut(s)	366, 490, 711, 732, 766, 802, 1127, 1186
BseGI	GGATG	4 cut(s)	54, 79, 858, 958
BseJI	GATNNNNATC	1 cut(s)	505
BseLI	CCNNNNNNNGG	4 cut(s)	373, 519, 755, 1214
BseMI	GCAATG	3 cut(s)	258, 786, 870
BseMII	CTCAG	4 cut(s)	146, 470, 633, 962
BseNI	ACTGG	4 cut(s)	550, 602, 812, 1096
BseRI	GAGGAG	4 cut(s)	301, 409, 444, 849
BseXI	GCAGC	5 cut(s)	707, 778, 901, 931, 1091
BseYI	CCCAGC	1 cut(s)	824
BshFI	GGCC	2 cut(s)	683, 765
BsiHKAI	GWGCWC	1 cut(s)	62
BsiHKCI	CYCGRG	2 cut(s)	264, 639
BsiSI	CCGG	3 cut(s)	368, 513, 1002
BslI	CCNNNNNNNGG	4 cut(s)	373, 519, 755, 1214
BsmI	GAATGC	1 cut(s)	201
BsnI	GGCC	2 cut(s)	683, 765
BsoBI	CYCGRG	2 cut(s)	264, 639
Bsp1286I	GDGCHC	1 cut(s)	62
Bsp1407I	TGTACA	2 cut(s)	321, 891
Bsp143I	GATC	6 cut(s)	215, 238, 370, 553, 863, 1131
Bsp19I	CCATGG	2 cut(s)	802, 1127
BspACI	CCGC	3 cut(s)	680, 685, 930
BspANI	GGCC	2 cut(s)	683, 765
BspCNI	CTCAG	4 cut(s)	147, 469, 632, 961
BspHI	TCATGA	2 cut(s)	271, 1156
BspLI	GGNNCC	3 cut(s)	240, 488, 858
BspMAI	CTGCAG	1 cut(s)	796
BspPI	GGATC	5 cut(s)	233, 246, 378, 548, 1139
BsrDI	GCAATG	3 cut(s)	258, 786, 870
BsrGI	TGTACA	2 cut(s)	321, 891
BsrI	ACTGG	4 cut(s)	550, 602, 812, 1096
BssECI	CCNNGG	8 cut(s)	366, 490, 711, 732, 766, 802, 1127, 1186
BssMI	GATC	6 cut(s)	215, 238, 370, 553, 863, 1131
BssNI	GRCGYC	2 cut(s)	624, 994
BssT1I	CCWWGG	4 cut(s)	490, 802, 1127, 1186
Bst2UI	CCWGG	5 cut(s)	391, 712, 734, 941, 1209
Bst4CI	ACNGT	3 cut(s)	167, 566, 1141
BstACI	GRCGYC	2 cut(s)	624, 994
BstAPI	GCANNNNNTGC	1 cut(s)	701
BstAUI	TGTACA	2 cut(s)	321, 891
BstC8I	GCNNGC	2 cut(s)	685, 773
BstDEI	CTNAG	5 cut(s)	155, 243, 456, 619, 948
BstDSI	CCRYGG	3 cut(s)	766, 802, 1127
BstF5I	GGATG	4 cut(s)	54, 79, 858, 958
BstKTI	GATC	6 cut(s)	218, 241, 373, 556, 866, 1134
BstMBI	GATC	6 cut(s)	215, 238, 370, 553, 863, 1131
BstMWI	GCNNNNNNNGC	4 cut(s)	134, 701, 788, 906
BstNI	CCWGG	5 cut(s)	391, 712, 734, 941, 1209
BstNSI	RCATGY	2 cut(s)	845, 1114
BstSCI	CCNGG	7 cut(s)	366, 389, 710, 732, 939, 1000, 1207
BstSFI	CTRYAG	2 cut(s)	792, 1168
BstV1I	GCAGC	5 cut(s)	707, 778, 901, 931, 1091
BstV2I	GAAGAC	1 cut(s)	1107
BstX2I	RGATCY	3 cut(s)	215, 238, 1131
BstXI	CCANNNNNNTGG	2 cut(s)	497, 1033
BstYI	RGATCY	3 cut(s)	215, 238, 1131
BsuI	GTATCC	1 cut(s)	178
BsuRI	GGCC	2 cut(s)	683, 765
BtgI	CCRYGG	3 cut(s)	766, 802, 1127
BtsCI	GGATG	4 cut(s)	54, 79, 858, 958
BtsI	GCAGTG	1 cut(s)	777
BtsIMutI	CAGTG	3 cut(s)	777, 819, 1137
Cac8I	GCNNGC	2 cut(s)	685, 773
CaiI	CAGNNNCTG	1 cut(s)	701
CciI	TCATGA	2 cut(s)	271, 1156
Cfr13I	GGNCC	4 cut(s)	415, 487, 682, 1094
CseI	GACGC	1 cut(s)	613
Csp6I	GTAC	2 cut(s)	322, 892
CviAII	CATG	8 cut(s)	272, 483, 660, 803, 842, 1111, 1128, 1157
CviQI	GTAC	2 cut(s)	322, 892
DdeI	CTNAG	5 cut(s)	155, 243, 456, 619, 948
DpnI	GATC	6 cut(s)	217, 240, 372, 555, 865, 1133
DpnII	GATC	6 cut(s)	215, 238, 370, 553, 863, 1131
DraI	TTTAAA	1 cut(s)	505
EaeI	YGGCCR	1 cut(s)	763
Ecl136II	GAGCTC	1 cut(s)	60
Eco130I	CCWWGG	4 cut(s)	490, 802, 1127, 1186
Eco24I	GRGCYC	1 cut(s)	62
Eco47I	GGWCC	3 cut(s)	415, 487, 1094
Eco53kI	GAGCTC	1 cut(s)	60
Eco57I	CTGAAG	2 cut(s)	335, 1105
Eco88I	CYCGRG	2 cut(s)	264, 639
EcoICRI	GAGCTC	1 cut(s)	60
EcoRI	GAATTC	1 cut(s)	807
EcoRII	CCWGG	5 cut(s)	389, 710, 732, 939, 1207
EcoT14I	CCWWGG	4 cut(s)	490, 802, 1127, 1186
EcoT38I	GRGCYC	1 cut(s)	62
ErhI	CCWWGG	4 cut(s)	490, 802, 1127, 1186
FaeI	CATG	8 cut(s)	275, 486, 663, 806, 845, 1114, 1131, 1160
FalI	AAGNNNNNCTT	2 cut(s)	1099, 1131
FatI	CATG	8 cut(s)	271, 482, 659, 802, 841, 1110, 1127, 1156
FauI	CCCGC	1 cut(s)	692
Fnu4HI	GCNGC	7 cut(s)	681, 696, 792, 915, 930, 945, 1080
FokI	GGATG	4 cut(s)	61, 86, 865, 965
FriOI	GRGCYC	1 cut(s)	62
Fsp4HI	GCNGC	7 cut(s)	681, 696, 792, 915, 930, 945, 1080
FspBI	CTAG	1 cut(s)	419
GluI	GCNGC	7 cut(s)	681, 696, 792, 915, 930, 945, 1080
GsaI	CCCAGC	1 cut(s)	828
HaeIII	GGCC	2 cut(s)	683, 765
HapII	CCGG	3 cut(s)	368, 513, 1002
HgaI	GACGC	1 cut(s)	613
Hin1I	GRCGYC	2 cut(s)	624, 994
Hin1II	CATG	8 cut(s)	275, 486, 663, 806, 845, 1114, 1131, 1160
HincII	GTYRAC	1 cut(s)	961
HindII	GTYRAC	1 cut(s)	961
HindIII	AAGCTT	4 cut(s)	383, 671, 898, 970
HinfI	GANTC	1 cut(s)	275
HpaII	CCGG	3 cut(s)	368, 513, 1002
HphI	GGTGA	2 cut(s)	770, 1092
Hpy166II	GTNNAC	3 cut(s)	470, 880, 961
Hpy188I	TCNGA	1 cut(s)	315
Hpy188III	TCNNGA	5 cut(s)	71, 272, 641, 950, 1157
Hpy8I	GTNNAC	3 cut(s)	470, 880, 961
HpyAV	CCTTC	2 cut(s)	512, 1129
HpyCH4III	ACNGT	3 cut(s)	167, 566, 1141
HpyCH4IV	ACGT	1 cut(s)	994
HpyCH4V	TGCA	8 cut(s)	22, 440, 663, 695, 794, 845, 1010, 1223
HpyF10VI	GCNNNNNNNGC	4 cut(s)	134, 701, 788, 906
HpyF3I	CTNAG	5 cut(s)	155, 243, 456, 619, 948
HpySE526I	ACGT	1 cut(s)	994
Hsp92I	GRCGYC	2 cut(s)	624, 994
Hsp92II	CATG	8 cut(s)	275, 486, 663, 806, 845, 1114, 1131, 1160
Kzo9I	GATC	6 cut(s)	215, 238, 370, 553, 863, 1131
LmnI	GCTCC	3 cut(s)	133, 479, 862
Lsp1109I	GCAGC	5 cut(s)	707, 778, 901, 931, 1091
LweI	GCATC	2 cut(s)	707, 838
MaeI	CTAG	1 cut(s)	419
MaeII	ACGT	1 cut(s)	994
MaeIII	GTNAC	4 cut(s)	112, 361, 634, 1198
MalI	GATC	6 cut(s)	217, 240, 372, 555, 865, 1133
MboI	GATC	6 cut(s)	215, 238, 370, 553, 863, 1131
MboII	GAAGA	3 cut(s)	18, 1107, 1126
MflI	RGATCY	3 cut(s)	215, 238, 1131
MhlI	GDGCHC	1 cut(s)	62
MlsI	TGGCCA	1 cut(s)	765
MluCI	AATT	4 cut(s)	9, 36, 580, 807
MluNI	TGGCCA	1 cut(s)	765
MmeI	TCCRAC	2 cut(s)	581, 1195
Mox20I	TGGCCA	1 cut(s)	765
MscI	TGGCCA	1 cut(s)	765
MseI	TTAA	5 cut(s)	35, 120, 342, 378, 504
MslI	CAYNNNNRTG	2 cut(s)	846, 1031
Msp20I	TGGCCA	1 cut(s)	765
MspI	CCGG	3 cut(s)	368, 513, 1002
MspR9I	CCNGG	7 cut(s)	368, 391, 712, 734, 941, 1002, 1209
Mva1269I	GAATGC	1 cut(s)	201
MvaI	CCWGG	5 cut(s)	391, 712, 734, 941, 1209
MwoI	GCNNNNNNNGC	4 cut(s)	134, 701, 788, 906
NciI	CCSGG	2 cut(s)	368, 1002
NcoI	CCATGG	2 cut(s)	802, 1127
NdeII	GATC	6 cut(s)	215, 238, 370, 553, 863, 1131
NlaIII	CATG	8 cut(s)	275, 486, 663, 806, 845, 1114, 1131, 1160
NlaIV	GGNNCC	3 cut(s)	240, 488, 858
NmuCI	GTSAC	2 cut(s)	112, 1198
NspI	RCATGY	2 cut(s)	845, 1114
PaeR7I	CTCGAG	2 cut(s)	264, 639
PagI	TCATGA	2 cut(s)	271, 1156
PctI	GAATGC	1 cut(s)	201
PfeI	GAWTC	1 cut(s)	275
PfoI	TCCNGGA	3 cut(s)	389, 1000, 1207
PkrI	GCNGC	7 cut(s)	682, 697, 793, 916, 931, 946, 1081
PshBI	ATTAAT	1 cut(s)	342
PsiI	TTATAA	1 cut(s)	968
Psp124BI	GAGCTC	1 cut(s)	62
Psp6I	CCWGG	5 cut(s)	389, 710, 732, 939, 1207
PspFI	CCCAGC	1 cut(s)	824
PspGI	CCWGG	5 cut(s)	389, 710, 732, 939, 1207
PspN4I	GGNNCC	3 cut(s)	240, 488, 858
PspPI	GGNCC	4 cut(s)	415, 487, 682, 1094
PspXI	VCTCGAGB	1 cut(s)	264
PstI	CTGCAG	1 cut(s)	796
PstNI	CAGNNNCTG	1 cut(s)	701
PsuI	RGATCY	3 cut(s)	215, 238, 1131
RsaI	GTAC	2 cut(s)	323, 893
RsaNI	GTAC	2 cut(s)	322, 892
RseI	CAYNNNNRTG	2 cut(s)	846, 1031
SacI	GAGCTC	1 cut(s)	62
SaqAI	TTAA	5 cut(s)	35, 120, 342, 378, 504
SatI	GCNGC	7 cut(s)	681, 696, 792, 915, 930, 945, 1080
Sau3AI	GATC	6 cut(s)	215, 238, 370, 553, 863, 1131
Sau96I	GGNCC	4 cut(s)	415, 487, 682, 1094
ScrFI	CCNGG	7 cut(s)	368, 391, 712, 734, 941, 1002, 1209
SduI	GDGCHC	1 cut(s)	62
SfaNI	GCATC	2 cut(s)	707, 838
SfcI	CTRYAG	2 cut(s)	792, 1168
Sfr274I	CTCGAG	2 cut(s)	264, 639
SinI	GGWCC	3 cut(s)	415, 487, 1094
SlaI	CTCGAG	2 cut(s)	264, 639
SmiI	ATTTAAAT	1 cut(s)	505
SmiMI	CAYNNNNRTG	2 cut(s)	846, 1031
SmlI	CTYRAG	2 cut(s)	264, 639
SmoI	CTYRAG	2 cut(s)	264, 639
Sse9I	AATT	4 cut(s)	9, 36, 580, 807
SsiI	CCGC	3 cut(s)	680, 685, 930
SspI	AATATT	1 cut(s)	226
SspMI	CTAG	1 cut(s)	419
SstI	GAGCTC	1 cut(s)	62
StyD4I	CCNGG	7 cut(s)	366, 389, 710, 732, 939, 1000, 1207
StyI	CCWWGG	4 cut(s)	490, 802, 1127, 1186
SwaI	ATTTAAAT	1 cut(s)	505
TaaI	ACNGT	3 cut(s)	167, 566, 1141
TaiI	ACGT	1 cut(s)	997
TaqI	TCGA	3 cut(s)	265, 640, 862
TasI	AATT	4 cut(s)	9, 36, 580, 807
TatI	WGTACW	2 cut(s)	321, 891
TauI	GCSGC	2 cut(s)	683, 932
TfiI	GAWTC	1 cut(s)	275
Tru1I	TTAA	5 cut(s)	35, 120, 342, 378, 504
Tru9I	TTAA	5 cut(s)	35, 120, 342, 378, 504
TscAI	CASTG	3 cut(s)	784, 819, 1144
TseFI	GTSAC	2 cut(s)	112, 1198
TseI	GCWGC	5 cut(s)	695, 791, 914, 944, 1079
Tsp45I	GTSAC	2 cut(s)	112, 1198
TspDTI	ATGAA	4 cut(s)	260, 267, 573, 648
TspGWI	ACGGA	1 cut(s)	251
TspRI	CASTG	3 cut(s)	784, 819, 1144
VpaK11BI	GGWCC	3 cut(s)	415, 487, 1094
VspI	ATTAAT	1 cut(s)	342
XapI	RAATTY	2 cut(s)	9, 807
XceI	RCATGY	2 cut(s)	845, 1114
XcmI	CCANNNNNNNNNTGG	1 cut(s)	480
XhoI	CTCGAG	2 cut(s)	264, 639
XspI	CTAG	1 cut(s)	419
ZraI	GACGTC	1 cut(s)	995

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.