Rmu_sc0003227.1_g000001

Protein CHLORORESPIRATORY REDUCTION 7

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0003227.1
Physical Location & Seq
Reverse (-)
700 .. 1617
918 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0003227.1_g000001.1.cds

Sequence Viewer

Length: 444 bp
atggttccaatggaaggagctttggagaaacagttatgccatagtggagttctctctatcaactgcaaacaagcaacaaagcaggagattcgaacccctttaaaccacctaatgtcgaccaataaaaccgagttcacaagttctgtagtccatcaccgaaatacagtcaaggtttgtgctgtgagaaggagaaggatacatactgatagtgaaacttatgtgttactggaaccaggagaggatgagaagtttgttacagaagaagagttgagggtcaagttgaaaggttggctggaaaactggccagccaagaaccttcctactgatcttgctagattcgaaagcattgatgaagctgttacttatttagtaaggtctgtttgtgaacttgaaatccatggagatgttggttcagttcagtggtacgaagttcgtttagaatga

Protein Analysis

147

Amino Acids

16.95

Weight (kDa)

5.89

Isoelectric Point (pI)

54.27

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0014482)

Species Orthologous Gene IDs
arabidopsis_thaliana AT5G39210
fragaria_vesca FvH4_6g46840
malus_domestica MD09G1066900.v1.1
prunus_persica Prupe.3G254800_v2.0.a1
pyrus_communis pycom111g05620 pycom17g05950
rosa_chinensis RchiOBHm_Chr2g0165831
rosa_laevigata RLG00000021560
rosa_multiflora Rmu_sc0003227.1_g000001 Rmu_sc0008709.1_g000001
rosa_roxburghii Rroxscaffold_2G00085460
rosa_rugosa Rorug02G0518200
rosa_samantha Rh2AG584000 Rh2BG595900 Rh2CG566900 Rh2DG605700
rosa_wichuraiana Rw2G048690

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 116
AcoI YGGCCR 1 cut(s) 302
AfaI GTAC 1 cut(s) 425
AfiI CCNNNNNNNGG 1 cut(s) 14
AgsI TTSAA 2 cut(s) 283, 392
AjnI CCWGG 1 cut(s) 232
AloI GAACNNNNNNTCC 2 cut(s) 378, 410
AluBI AGCT 2 cut(s) 20, 356
AluI AGCT 2 cut(s) 20, 356
AoxI GGCC 1 cut(s) 302
AsuHPI GGTGA 1 cut(s) 146
AsuII TTCGAA 2 cut(s) 91, 339
BalI TGGCCA 1 cut(s) 304
BarI GAAGNNNNNNTAC 2 cut(s) 184, 216
BccI CCATC 1 cut(s) 159
BcgI CGANNNNNNTGC 2 cut(s) 71, 105
BciT130I CCWGG 1 cut(s) 234
BciVI GTATCC 1 cut(s) 189
BfaI CTAG 1 cut(s) 333
BfmI CTRYAG 1 cut(s) 144
BfuI GTATCC 1 cut(s) 189
Bme1390I CCNGG 1 cut(s) 234
BmiI GGNNCC 2 cut(s) 6, 231
BmrFI CCNGG 1 cut(s) 234
Bpu14I TTCGAA 2 cut(s) 91, 339
BsaJI CCNNGG 1 cut(s) 397
BsaXI ACNNNNNCTCC 2 cut(s) 17, 47
Bsc4I CCNNNNNNNGG 1 cut(s) 14
Bse1I ACTGG 2 cut(s) 231, 305
BseBI CCWGG 1 cut(s) 234
BseDI CCNNGG 1 cut(s) 397
BseGI GGATG 1 cut(s) 247
BseLI CCNNNNNNNGG 1 cut(s) 14
BseNI ACTGG 2 cut(s) 231, 305
BshFI GGCC 1 cut(s) 304
BslI CCNNNNNNNGG 1 cut(s) 14
BsnI GGCC 1 cut(s) 304
Bsp119I TTCGAA 2 cut(s) 91, 339
Bsp143I GATC 1 cut(s) 325
Bsp19I CCATGG 1 cut(s) 397
BspANI GGCC 1 cut(s) 304
BspLI GGNNCC 2 cut(s) 6, 231
BspT104I TTCGAA 2 cut(s) 91, 339
BsrI ACTGG 2 cut(s) 231, 305
BssECI CCNNGG 1 cut(s) 397
BssMI GATC 1 cut(s) 325
BssT1I CCWWGG 1 cut(s) 397
Bst2UI CCWGG 1 cut(s) 234
Bst4CI ACNGT 2 cut(s) 33, 166
Bst6I CTCTTC 1 cut(s) 258
BstBI TTCGAA 2 cut(s) 91, 339
BstC8I GCNNGC 1 cut(s) 306
BstDSI CCRYGG 1 cut(s) 397
BstF5I GGATG 1 cut(s) 247
BstKTI GATC 1 cut(s) 328
BstMBI GATC 1 cut(s) 325
BstNI CCWGG 1 cut(s) 234
BstSCI CCNGG 1 cut(s) 232
BstSFI CTRYAG 1 cut(s) 144
BsuI GTATCC 1 cut(s) 189
BsuRI GGCC 1 cut(s) 304
BtgI CCRYGG 1 cut(s) 397
BtsCI GGATG 1 cut(s) 247
BtsIMutI CAGTG 1 cut(s) 425
Cac8I GCNNGC 1 cut(s) 306
Csp6I GTAC 1 cut(s) 424
CviAII CATG 1 cut(s) 398
CviJI RGCY 5 cut(s) 20, 292, 304, 308, 356
CviKI_1 RGCY 5 cut(s) 20, 292, 304, 308, 356
CviQI GTAC 1 cut(s) 424
DpnI GATC 1 cut(s) 327
DpnII GATC 1 cut(s) 325
DraI TTTAAA 1 cut(s) 102
EaeI YGGCCR 1 cut(s) 302
Eam1104I CTCTTC 1 cut(s) 258
EarI CTCTTC 1 cut(s) 258
Eco130I CCWWGG 1 cut(s) 397
EcoRII CCWGG 1 cut(s) 232
EcoT14I CCWWGG 1 cut(s) 397
ErhI CCWWGG 1 cut(s) 397
FaeI CATG 1 cut(s) 401
FaiI YATR 5 cut(s) 37, 42, 201, 219, 399
FatI CATG 1 cut(s) 397
FblI GTMKAC 1 cut(s) 116
FokI GGATG 1 cut(s) 254
FspBI CTAG 1 cut(s) 333
HaeIII GGCC 1 cut(s) 304
Hin1II CATG 1 cut(s) 401
HincII GTYRAC 1 cut(s) 117
HindII GTYRAC 1 cut(s) 117
HinfI GANTC 2 cut(s) 88, 336
HphI GGTGA 1 cut(s) 146
Hpy166II GTNNAC 3 cut(s) 117, 135, 386
Hpy8I GTNNAC 3 cut(s) 117, 135, 386
HpyAV CCTTC 4 cut(s) 8, 180, 186, 326
HpyCH4III ACNGT 2 cut(s) 33, 166
HpyCH4V TGCA 1 cut(s) 66
Hsp92II CATG 1 cut(s) 401
Kzo9I GATC 1 cut(s) 325
LmnI GCTCC 1 cut(s) 17
LpnPI CCDG 7 cut(s) 68, 212, 219, 246, 278, 286, 318
MaeI CTAG 1 cut(s) 333
MaeIII GTNAC 3 cut(s) 222, 253, 358
MalI GATC 1 cut(s) 327
MboI GATC 1 cut(s) 325
MboII GAAGA 2 cut(s) 272, 275
MlsI TGGCCA 1 cut(s) 304
MluNI TGGCCA 1 cut(s) 304
MnlI CCTC 2 cut(s) 232, 264
Mox20I TGGCCA 1 cut(s) 304
MscI TGGCCA 1 cut(s) 304
MseI TTAA 1 cut(s) 101
MslI CAYNNNNRTG 1 cut(s) 402
Msp20I TGGCCA 1 cut(s) 304
MspR9I CCNGG 1 cut(s) 234
MvaI CCWGG 1 cut(s) 234
NcoI CCATGG 1 cut(s) 397
NdeII GATC 1 cut(s) 325
NlaIII CATG 1 cut(s) 401
NlaIV GGNNCC 2 cut(s) 6, 231
NspV TTCGAA 2 cut(s) 91, 339
PfeI GAWTC 2 cut(s) 88, 336
Psp6I CCWGG 1 cut(s) 232
PspGI CCWGG 1 cut(s) 232
PspN4I GGNNCC 2 cut(s) 6, 231
RsaI GTAC 1 cut(s) 425
RsaNI GTAC 1 cut(s) 424
RseI CAYNNNNRTG 1 cut(s) 402
SalI GTCGAC 1 cut(s) 115
SaqAI TTAA 1 cut(s) 101
Sau3AI GATC 1 cut(s) 325
ScrFI CCNGG 1 cut(s) 234
SetI ASST 7 cut(s) 22, 111, 174, 289, 318, 358, 377
SfcI CTRYAG 1 cut(s) 144
SfuI TTCGAA 2 cut(s) 91, 339
SmiMI CAYNNNNRTG 1 cut(s) 402
SspMI CTAG 1 cut(s) 333
StyD4I CCNGG 1 cut(s) 232
StyI CCWWGG 1 cut(s) 397
TaaI ACNGT 2 cut(s) 33, 166
TaqI TCGA 3 cut(s) 91, 116, 339
TfiI GAWTC 2 cut(s) 88, 336
Tru1I TTAA 1 cut(s) 101
Tru9I TTAA 1 cut(s) 101
TscAI CASTG 1 cut(s) 425
TspDTI ATGAA 1 cut(s) 366
TspRI CASTG 1 cut(s) 425
XcmI CCANNNNNNNNNTGG 1 cut(s) 404
XmiI GTMKAC 1 cut(s) 116
XspI CTAG 1 cut(s) 333
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.