Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0003458.1

Orthogroup ID

OG0009324

Physical Location & Seq

Genomic Coordinates Forward (+)

75011 .. 76826

Gene Structure 1816 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0003458.1_g000015.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 870 bp

atgtatgttggggtaaccataaggagatacagagctattcaggacgttgggaaatttatgatgtatgttgggatcattgcctactaccaactgatgcaagtttgccaggctgaatattttcgtcagttgcttaaacctagtgaccaagcatttgacccaaacaaggcagcacggccctttgcaaatcaagtgggtaataactacatgcatatgcctgtggcatctccttttggtactgttttacctcatgatgcaatgcactacaaacccttccatggtgttgaatttcaaacctctgacatttgcccaaagaatttcataatcttcgaccagactgatcatcgcagtcagattatgttcaatcctgcaattgcccacaaaatttctggtcctgcctttgacatctgtgcagcttacgtgcaagacaatttgggattgattgagggaaataatgagaatagagaaacatcttcatctctgaaggaggattcagatgatattgatgcattgttgagcttggaagatgaagaagagcaagaagaatatgatgaggaagaggtcagtacagcacgaactcatggaaactatgggagttcatactctgattcttgctccagttatggtttgaaaaccaggaatgaagggcagaatttttcacttgaaaaaacttctggcattggtagcagcagcagcagctgcaacagtgaacgaaaacgaaagaaaatgaagaagatggtgagagcactaagagggattgtacctggtgggaatgaaatgaacacggttgctgttatagatgaagctgttcagtacttgaagtctctcaaagtcgagatgcagaagcttggagttgggaatttgaataactaa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003700 GO:0006355 GO:0008150 GO:0009889 GO:0010468 GO:0010556 GO:0019219 GO:0019222 GO:0031323 GO:0031326 GO:0050789 GO:0050794 GO:0051171 GO:0051252 GO:0060255 GO:0065007 GO:0080090 GO:0140110 GO:1903506 GO:2000112 GO:2001141

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

289

Amino Acids

32.44

Weight (kDa)

5.44

Isoelectric Point (pI)

49.67

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0009324)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G29950 AT1G29950
fragaria_vesca	FvH4_3g06000
malus_domestica	MD05G1288000.v1.1 MD05G1288300.v1.1 MD05G1288500.v1.1 MD05G1288800.v1.1 MD10G1264900.v1.1
prunus_persica	Prupe.4G077100_v2.0.a1
pyrus_communis	pycom05g26630 pycom10g22100
rosa_chinensis	RchiOBHm_Chr5g0013411
rosa_laevigata	RLG00000032017
rosa_multiflora	Rmu_sc0003458.1_g000015
rosa_roxburghii	Rroxscaffold_1G00063150
rosa_rugosa	Rorug05G0009000 Rorug05G0009100
rosa_samantha	Rh5AG104500 Rh5BG100800 Rh5CG112700 Rh5DG099400
rosa_wichuraiana	Rw5G009110

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AclWI	GGATC	1 cut(s)	80
AcsI	RAATTY	6 cut(s)	53, 284, 313, 381, 649, 856
AcuI	CTGAAG	1 cut(s)	500
AfaI	GTAC	4 cut(s)	235, 565, 759, 812
AfiI	CCNNNNNNNGG	2 cut(s)	163, 275
AgsI	TTSAA	7 cut(s)	284, 290, 361, 628, 662, 817, 862
AjnI	CCWGG	3 cut(s)	105, 632, 760
AluBI	AGCT	6 cut(s)	35, 413, 516, 696, 803, 844
AluI	AGCT	6 cut(s)	35, 413, 516, 696, 803, 844
Alw21I	GWGCWC	1 cut(s)	745
Alw26I	GTCTC	1 cut(s)	825
AlwI	GGATC	1 cut(s)	80
AlwNI	CAGNNNCTG	1 cut(s)	696
AoxI	GGCC	1 cut(s)	173
ApeKI	GCWGC	7 cut(s)	167, 410, 684, 687, 690, 693, 696
ApoI	RAATTY	6 cut(s)	53, 284, 313, 381, 649, 856
ArsI	GACNNNNNNTTYG	2 cut(s)	134, 166
Asp700I	GAANNNNTTC	2 cut(s)	117, 804
AspS9I	GGNCC	2 cut(s)	174, 389
AsuHPI	GGTGA	1 cut(s)	748
AvaII	GGWCC	1 cut(s)	389
Bbv12I	GWGCWC	1 cut(s)	745
BbvI	GCAGC	7 cut(s)	179, 422, 683, 696, 699, 702, 705
BccI	CCATC	1 cut(s)	727
BceAI	ACGGC	1 cut(s)	188
BciT130I	CCWGG	3 cut(s)	107, 634, 762
BclI	TGATCA	1 cut(s)	337
BcoDI	GTCTC	1 cut(s)	825
BfaI	CTAG	1 cut(s)	138
BisI	GCNGC	7 cut(s)	168, 411, 685, 688, 691, 694, 697
BlsI	GCNGC	7 cut(s)	169, 412, 686, 689, 692, 695, 698
BmcAI	AGTACT	1 cut(s)	812
Bme1390I	CCNGG	3 cut(s)	107, 634, 762
Bme18I	GGWCC	1 cut(s)	389
BmgT120I	GGNCC	2 cut(s)	174, 389
BmrFI	CCNGG	3 cut(s)	107, 634, 762
BmsI	GCATC	5 cut(s)	84, 230, 241, 493, 825
BpmI	CTGGAG	1 cut(s)	598
BsaAI	YACGTR	1 cut(s)	418
BsaJI	CCNNGG	1 cut(s)	274
Bsc4I	CCNNNNNNNGG	2 cut(s)	163, 275
Bse1I	ACTGG	1 cut(s)	615
Bse3DI	GCAATG	2 cut(s)	75, 261
BseBI	CCWGG	3 cut(s)	107, 634, 762
BseDI	CCNNGG	1 cut(s)	274
BseLI	CCNNNNNNNGG	2 cut(s)	163, 275
BseMI	GCAATG	2 cut(s)	75, 261
BseNI	ACTGG	1 cut(s)	615
BseXI	GCAGC	7 cut(s)	179, 422, 683, 696, 699, 702, 705
BsgI	GTGCAG	1 cut(s)	429
BshFI	GGCC	1 cut(s)	175
BsiHKAI	GWGCWC	1 cut(s)	745
BslI	CCNNNNNNNGG	2 cut(s)	163, 275
BsmAI	GTCTC	1 cut(s)	825
BsnI	GGCC	1 cut(s)	175
Bsp1286I	GDGCHC	1 cut(s)	745
Bsp143I	GATC	2 cut(s)	72, 337
Bsp19I	CCATGG	1 cut(s)	274
BspANI	GGCC	1 cut(s)	175
BspHI	TCATGA	1 cut(s)	247
BspPI	GGATC	1 cut(s)	80
BspQI	GCTCTTC	1 cut(s)	525
BsrDI	GCAATG	2 cut(s)	75, 261
BsrI	ACTGG	1 cut(s)	615
BssECI	CCNNGG	1 cut(s)	274
BssMI	GATC	2 cut(s)	72, 337
BssT1I	CCWWGG	1 cut(s)	274
Bst2UI	CCWGG	3 cut(s)	107, 634, 762
Bst4CI	ACNGT	3 cut(s)	238, 704, 784
Bst6I	CTCTTC	2 cut(s)	525, 549
BstAPI	GCANNNNNTGC	1 cut(s)	696
BstBAI	YACGTR	1 cut(s)	418
BstDEI	CTNAG	1 cut(s)	746
BstDSI	CCRYGG	1 cut(s)	274
BstEII	GGTNACC	1 cut(s)	13
BstKTI	GATC	2 cut(s)	75, 340
BstMAI	GTCTC	1 cut(s)	825
BstMBI	GATC	2 cut(s)	72, 337
BstMWI	GCNNNNNNNGC	4 cut(s)	681, 690, 693, 696
BstNI	CCWGG	3 cut(s)	107, 634, 762
BstNSI	RCATGY	1 cut(s)	208
BstPI	GGTNACC	1 cut(s)	13
BstSCI	CCNGG	3 cut(s)	105, 632, 760
BstV1I	GCAGC	7 cut(s)	179, 422, 683, 696, 699, 702, 705
BsuRI	GGCC	1 cut(s)	175
BtgI	CCRYGG	1 cut(s)	274
BtgZI	GCGATG	1 cut(s)	326
BtsIMutI	CAGTG	1 cut(s)	709
CaiI	CAGNNNCTG	1 cut(s)	696
CciI	TCATGA	1 cut(s)	247
Cfr13I	GGNCC	2 cut(s)	174, 389
CsiI	ACCWGGT	1 cut(s)	760
Csp6I	GTAC	4 cut(s)	234, 564, 758, 811
CspCI	CAANNNNNGTGG	2 cut(s)	171, 206
CviAII	CATG	4 cut(s)	205, 248, 275, 578
CviJI	RGCY	8 cut(s)	35, 110, 175, 413, 516, 696, 803, 844
CviKI_1	RGCY	8 cut(s)	35, 110, 175, 413, 516, 696, 803, 844
CviQI	GTAC	4 cut(s)	234, 564, 758, 811
DdeI	CTNAG	1 cut(s)	746
DpnI	GATC	2 cut(s)	74, 339
DpnII	GATC	2 cut(s)	72, 337
Eam1104I	CTCTTC	2 cut(s)	525, 549
EarI	CTCTTC	2 cut(s)	525, 549
Eco130I	CCWWGG	1 cut(s)	274
Eco47I	GGWCC	1 cut(s)	389
Eco57I	CTGAAG	1 cut(s)	500
Eco91I	GGTNACC	1 cut(s)	13
EcoO65I	GGTNACC	1 cut(s)	13
EcoRII	CCWGG	3 cut(s)	105, 632, 760
EcoT14I	CCWWGG	1 cut(s)	274
EcoT22I	ATGCAT	2 cut(s)	210, 508
ErhI	CCWWGG	1 cut(s)	274
FaeI	CATG	4 cut(s)	208, 251, 278, 581
FatI	CATG	4 cut(s)	204, 247, 274, 577
FauNDI	CATATG	1 cut(s)	210
FbaI	TGATCA	1 cut(s)	337
Fnu4HI	GCNGC	7 cut(s)	168, 411, 685, 688, 691, 694, 697
Fsp4HI	GCNGC	7 cut(s)	168, 411, 685, 688, 691, 694, 697
FspBI	CTAG	1 cut(s)	138
GluI	GCNGC	7 cut(s)	168, 411, 685, 688, 691, 694, 697
GsuI	CTGGAG	1 cut(s)	598
HaeIII	GGCC	1 cut(s)	175
Hin1II	CATG	4 cut(s)	208, 251, 278, 581
HindIII	AAGCTT	1 cut(s)	842
HinfI	GANTC	2 cut(s)	488, 605
HphI	GGTGA	1 cut(s)	748
Hpy166II	GTNNAC	1 cut(s)	707
Hpy188I	TCNGA	5 cut(s)	298, 351, 480, 493, 604
Hpy188III	TCNNGA	3 cut(s)	41, 248, 832
Hpy8I	GTNNAC	1 cut(s)	707
HpyAV	CCTTC	3 cut(s)	280, 475, 635
HpyCH4III	ACNGT	3 cut(s)	238, 704, 784
HpyCH4IV	ACGT	2 cut(s)	45, 417
HpyF10VI	GCNNNNNNNGC	4 cut(s)	681, 690, 693, 696
HpyF3I	CTNAG	1 cut(s)	746
HpySE526I	ACGT	2 cut(s)	45, 417
Hsp92II	CATG	4 cut(s)	208, 251, 278, 581
Ksp22I	TGATCA	1 cut(s)	337
Kzo9I	GATC	2 cut(s)	72, 337
LguI	GCTCTTC	1 cut(s)	525
LmnI	GCTCC	1 cut(s)	617
Lsp1109I	GCAGC	7 cut(s)	179, 422, 683, 696, 699, 702, 705
LweI	GCATC	5 cut(s)	84, 230, 241, 493, 825
MabI	ACCWGGT	1 cut(s)	760
MaeI	CTAG	1 cut(s)	138
MaeII	ACGT	2 cut(s)	45, 417
MaeIII	GTNAC	2 cut(s)	13, 140
MalI	GATC	2 cut(s)	74, 339
MboI	GATC	2 cut(s)	72, 337
MboII	GAAGA	9 cut(s)	316, 462, 533, 539, 542, 551, 566, 739, 742
MfeI	CAATTG	1 cut(s)	369
MhlI	GDGCHC	1 cut(s)	745
MluCI	AATT	8 cut(s)	53, 284, 313, 369, 381, 427, 649, 856
MnlI	CCTC	7 cut(s)	255, 304, 436, 478, 544, 550, 743
Mph1103I	ATGCAT	2 cut(s)	210, 508
MroXI	GAANNNNTTC	2 cut(s)	117, 804
MseI	TTAA	1 cut(s)	132
MslI	CAYNNNNRTG	1 cut(s)	209
MspA1I	CMGCKG	1 cut(s)	696
MspR9I	CCNGG	3 cut(s)	107, 634, 762
MunI	CAATTG	1 cut(s)	369
MvaI	CCWGG	3 cut(s)	107, 634, 762
MwoI	GCNNNNNNNGC	4 cut(s)	681, 690, 693, 696
NcoI	CCATGG	1 cut(s)	274
NdeI	CATATG	1 cut(s)	210
NdeII	GATC	2 cut(s)	72, 337
NlaIII	CATG	4 cut(s)	208, 251, 278, 581
NmuCI	GTSAC	1 cut(s)	140
NsiI	ATGCAT	2 cut(s)	210, 508
NspI	RCATGY	1 cut(s)	208
PagI	TCATGA	1 cut(s)	247
PciSI	GCTCTTC	1 cut(s)	525
PdmI	GAANNNNTTC	2 cut(s)	117, 804
PfeI	GAWTC	2 cut(s)	488, 605
PkrI	GCNGC	7 cut(s)	169, 412, 686, 689, 692, 695, 698
Ppu21I	YACGTR	1 cut(s)	418
Psp6I	CCWGG	3 cut(s)	105, 632, 760
PspEI	GGTNACC	1 cut(s)	13
PspGI	CCWGG	3 cut(s)	105, 632, 760
PspPI	GGNCC	2 cut(s)	174, 389
PstNI	CAGNNNCTG	1 cut(s)	696
PvuII	CAGCTG	1 cut(s)	696
RsaI	GTAC	4 cut(s)	235, 565, 759, 812
RsaNI	GTAC	4 cut(s)	234, 564, 758, 811
RseI	CAYNNNNRTG	1 cut(s)	209
SapI	GCTCTTC	1 cut(s)	525
SaqAI	TTAA	1 cut(s)	132
SatI	GCNGC	7 cut(s)	168, 411, 685, 688, 691, 694, 697
Sau3AI	GATC	2 cut(s)	72, 337
Sau96I	GGNCC	2 cut(s)	174, 389
ScaI	AGTACT	1 cut(s)	812
ScrFI	CCNGG	3 cut(s)	107, 634, 762
SduI	GDGCHC	1 cut(s)	745
SexAI	ACCWGGT	1 cut(s)	760
SfaNI	GCATC	5 cut(s)	84, 230, 241, 493, 825
SinI	GGWCC	1 cut(s)	389
SmiMI	CAYNNNNRTG	1 cut(s)	209
Sse9I	AATT	8 cut(s)	53, 284, 313, 369, 381, 427, 649, 856
SspI	AATATT	1 cut(s)	116
SspMI	CTAG	1 cut(s)	138
StyD4I	CCNGG	3 cut(s)	105, 632, 760
StyI	CCWWGG	1 cut(s)	274
TaaI	ACNGT	3 cut(s)	238, 704, 784
TaiI	ACGT	2 cut(s)	48, 420
TaqI	TCGA	2 cut(s)	327, 831
TasI	AATT	8 cut(s)	53, 284, 313, 369, 381, 427, 649, 856
TatI	WGTACW	2 cut(s)	563, 810
TfiI	GAWTC	2 cut(s)	488, 605
Tru1I	TTAA	1 cut(s)	132
Tru9I	TTAA	1 cut(s)	132
TscAI	CASTG	1 cut(s)	709
TseFI	GTSAC	1 cut(s)	140
TseI	GCWGC	7 cut(s)	167, 410, 684, 687, 690, 693, 696
Tsp45I	GTSAC	1 cut(s)	140
TspDTI	ATGAA	9 cut(s)	307, 462, 540, 585, 654, 740, 786, 791, 813
TspRI	CASTG	1 cut(s)	709
VpaK11BI	GGWCC	1 cut(s)	389
XapI	RAATTY	6 cut(s)	53, 284, 313, 381, 649, 856
XceI	RCATGY	1 cut(s)	208
XcmI	CCANNNNNNNNNTGG	1 cut(s)	383
XmnI	GAANNNNTTC	2 cut(s)	117, 804
XspI	CTAG	1 cut(s)	138
ZrmI	AGTACT	1 cut(s)	812
Zsp2I	ATGCAT	2 cut(s)	210, 508

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.