Rmu_sc0003546.1_g000017

Essential component of the PAM complex, a complex required for the translocation of transit peptide-containing proteins from the inner membrane into the mitochondrial matrix in an ATP-dependent manner

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0003546.1
Physical Location & Seq
Forward (+)
82216 .. 86796
4581 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0003546.1_g000017.1.cds

Sequence Viewer

Length: 999 bp
atggccaatgtcctccgaagttcggcgttgagggcaccattggctccgcttccaacagctgtctcgcccaactctcccaaacccttttacgtttcgtttagacgacagaggcatcccattctccgcttctctcacttgccctccctccgcctcctcgtgcctttcgcttcccacaacaagcacggtgaaaccgatgctacggacaccctcgatgcagaggagcttgaggaggattccttagacggggcagttagtgtggaagatagtacaagtgatgctgaagaaagtggtacaagtgatgatggggaaggtgatgacaaaaaacctgtttcagccatcatagcgtcactacaattatacaaagaagctttagccagtaatgatgaatcaaaagtagccgagattgaatcttttctaaaatctgttgaagatgaaaaaatagaccttgaaaggaaagtggcttctttgtctgaagaactgtcagcagggaaggttcggattctgaggattagtgcagactttgataatttccggaaaaggacagatagagaacgcatttcactggtaactaatgctcagggggaagttgtggagagcttgttgggtgtattggataattttgagagggctaaagcccagattaaggtggagacagagggagaggagaagatcaacaatagctatcagagcatttataaacagtttggagaaatcttaagttcacttggcgttctcccggtggagacagtggggaagccctttgatccgttgttgcatgaagcaattatgcgtgaggagtcttcagaatttgaagaaggtattatactagatgaatttcgcaaggggtttaagcttggtgacaggcttctgcgtccatcaatggtaaaggtatcagctggtccagggcctgccaagccagagcagcaagtagctccatctgaggaacatgatgcaagtgaagcgaccaaggaggacatcacagaggagtgcattctttga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

332

Amino Acids

36.62

Weight (kDa)

4.7

Isoelectric Point (pI)

55.03

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 696
AccB1I GGYRCC 1 cut(s) 34
AccIII TCCGGA 1 cut(s) 531
AciI CCGC 3 cut(s) 47, 124, 148
AclWI GGATC 1 cut(s) 758
AcoI YGGCCR 1 cut(s) 3
AcsI RAATTY 2 cut(s) 806, 833
AcuI CTGAAG 3 cut(s) 300, 492, 786
AfaI GTAC 2 cut(s) 268, 292
AfiI CCNNNNNNNGG 3 cut(s) 22, 243, 643
AflII CTTAAG 1 cut(s) 715
AgsI TTSAA 4 cut(s) 407, 428, 449, 812
AjnI CCWGG 1 cut(s) 901
AluBI AGCT 8 cut(s) 59, 223, 368, 597, 681, 853, 896, 932
AluI AGCT 8 cut(s) 59, 223, 368, 597, 681, 853, 896, 932
Alw26I GTCTC 3 cut(s) 67, 644, 737
AlwI GGATC 1 cut(s) 758
AlwNI CAGNNNCTG 1 cut(s) 908
Aor13HI TCCGGA 1 cut(s) 531
AoxI GGCC 2 cut(s) 3, 905
ApeKI GCWGC 1 cut(s) 922
ApoI RAATTY 2 cut(s) 806, 833
Asp700I GAANNNNTTC 1 cut(s) 411
AspS9I GGNCC 2 cut(s) 899, 905
AsuC2I CCSGG 1 cut(s) 737
AsuHPI GGTGA 3 cut(s) 197, 323, 869
AvaII GGWCC 1 cut(s) 899
BaeGI GKGCMC 1 cut(s) 37
BalI TGGCCA 1 cut(s) 5
BanI GGYRCC 1 cut(s) 34
BarI GAAGNNNNNNTAC 2 cut(s) 807, 839
BauI CACGAG 1 cut(s) 155
BbsI GAAGAC 1 cut(s) 792
BbvI GCAGC 1 cut(s) 934
BccI CCATC 4 cut(s) 296, 344, 883, 943
BciT130I CCWGG 1 cut(s) 903
BcnI CCSGG 1 cut(s) 737
BcoDI GTCTC 3 cut(s) 67, 644, 737
BfaI CTAG 1 cut(s) 827
BfrI CTTAAG 1 cut(s) 715
BisI GCNGC 1 cut(s) 923
BlsI GCNGC 1 cut(s) 924
Bme1390I CCNGG 2 cut(s) 737, 903
Bme18I GGWCC 1 cut(s) 899
BmgT120I GGNCC 2 cut(s) 899, 905
BmiI GGNNCC 2 cut(s) 36, 45
BmrFI CCNGG 2 cut(s) 737, 903
BmsI GCATC 5 cut(s) 121, 184, 202, 265, 940
BpiI GAAGAC 1 cut(s) 792
Bpu10I CCTNAGC 1 cut(s) 576
BpuEI CTTGAG 1 cut(s) 245
BpuMI CCSGG 1 cut(s) 737
BsaJI CCNNGG 2 cut(s) 902, 966
BsaWI WCCGGW 1 cut(s) 531
BsaXI ACNNNNNCTCC 4 cut(s) 125, 155, 584, 614
Bsc4I CCNNNNNNNGG 3 cut(s) 22, 243, 643
Bse1I ACTGG 2 cut(s) 375, 567
BseAI TCCGGA 1 cut(s) 531
BseBI CCWGG 1 cut(s) 903
BseDI CCNNGG 2 cut(s) 902, 966
BseGI GGATG 1 cut(s) 112
BseLI CCNNNNNNNGG 3 cut(s) 22, 243, 643
BseMII CTCAG 3 cut(s) 494, 590, 930
BseNI ACTGG 2 cut(s) 375, 567
BseRI GAGGAG 6 cut(s) 143, 233, 242, 677, 809, 998
BseSI GKGCMC 1 cut(s) 37
BseXI GCAGC 1 cut(s) 934
BsgI GTGCAG 1 cut(s) 534
BshFI GGCC 2 cut(s) 5, 907
BshNI GGYRCC 1 cut(s) 34
BsiSI CCGG 2 cut(s) 532, 737
BslI CCNNNNNNNGG 3 cut(s) 22, 243, 643
BsmAI GTCTC 3 cut(s) 67, 644, 737
BsmI GAATGC 1 cut(s) 990
BsnI GGCC 2 cut(s) 5, 907
Bsp1286I GDGCHC 1 cut(s) 37
Bsp13I TCCGGA 1 cut(s) 531
Bsp143I GATC 2 cut(s) 669, 763
BspACI CCGC 3 cut(s) 47, 124, 148
BspANI GGCC 2 cut(s) 5, 907
BspCNI CTCAG 3 cut(s) 495, 589, 931
BspEI TCCGGA 1 cut(s) 531
BspLI GGNNCC 2 cut(s) 36, 45
BspPI GGATC 1 cut(s) 758
BspT107I GGYRCC 1 cut(s) 34
BspTI CTTAAG 1 cut(s) 715
BsrI ACTGG 2 cut(s) 375, 567
BssECI CCNNGG 2 cut(s) 902, 966
BssMI GATC 2 cut(s) 669, 763
BssSI CACGAG 1 cut(s) 155
BssT1I CCWWGG 1 cut(s) 966
Bst2BI CACGAG 1 cut(s) 155
Bst2UI CCWGG 1 cut(s) 903
Bst4CI ACNGT 4 cut(s) 185, 480, 702, 748
BstAFI CTTAAG 1 cut(s) 715
BstC8I GCNNGC 1 cut(s) 909
BstDEI CTNAG 4 cut(s) 238, 503, 576, 939
BstF5I GGATG 1 cut(s) 112
BstKTI GATC 2 cut(s) 672, 766
BstMAI GTCTC 3 cut(s) 67, 644, 737
BstMBI GATC 2 cut(s) 669, 763
BstMWI GCNNNNNNNGC 7 cut(s) 32, 41, 341, 687, 913, 922, 959
BstNI CCWGG 1 cut(s) 903
BstSCI CCNGG 2 cut(s) 735, 901
BstSLI GKGCMC 1 cut(s) 37
BstV1I GCAGC 1 cut(s) 934
BstV2I GAAGAC 1 cut(s) 792
BsuRI GGCC 2 cut(s) 5, 907
BtsCI GGATG 1 cut(s) 112
BtsIMutI CAGTG 2 cut(s) 560, 753
Cac8I GCNNGC 1 cut(s) 909
CaiI CAGNNNCTG 1 cut(s) 908
Cfr13I GGNCC 2 cut(s) 899, 905
CseI GACGC 2 cut(s) 333, 860
Csp6I GTAC 2 cut(s) 267, 291
CviAII CATG 2 cut(s) 776, 947
CviQI GTAC 2 cut(s) 267, 291
DdeI CTNAG 4 cut(s) 238, 503, 576, 939
DpnI GATC 2 cut(s) 671, 765
DpnII GATC 2 cut(s) 669, 763
EaeI YGGCCR 1 cut(s) 3
EciI GGCGGA 1 cut(s) 137
Eco130I CCWWGG 1 cut(s) 966
Eco47I GGWCC 1 cut(s) 899
Eco57I CTGAAG 3 cut(s) 300, 492, 786
EcoO109I RGGNCCY 1 cut(s) 905
EcoRII CCWGG 1 cut(s) 901
EcoT14I CCWWGG 1 cut(s) 966
ErhI CCWWGG 1 cut(s) 966
FaeI CATG 2 cut(s) 779, 950
FaiI YATR 7 cut(s) 341, 358, 696, 777, 788, 824, 948
FatI CATG 2 cut(s) 775, 946
Fnu4HI GCNGC 1 cut(s) 923
FokI GGATG 1 cut(s) 99
Fsp4HI GCNGC 1 cut(s) 923
FspBI CTAG 1 cut(s) 827
GluI GCNGC 1 cut(s) 923
HaeIII GGCC 2 cut(s) 5, 907
HapII CCGG 2 cut(s) 532, 737
HgaI GACGC 2 cut(s) 333, 860
Hin1II CATG 2 cut(s) 779, 950
HindIII AAGCTT 2 cut(s) 366, 851
HinfI GANTC 5 cut(s) 233, 386, 407, 499, 797
HpaII CCGG 2 cut(s) 532, 737
HphI GGTGA 3 cut(s) 197, 323, 869
Hpy166II GTNNAC 1 cut(s) 722
Hpy188I TCNGA 7 cut(s) 17, 472, 498, 504, 687, 805, 940
Hpy188III TCNNGA 1 cut(s) 532
Hpy8I GTNNAC 1 cut(s) 722
HpyAV CCTTC 3 cut(s) 302, 484, 809
HpyCH4III ACNGT 4 cut(s) 185, 480, 702, 748
HpyCH4IV ACGT 1 cut(s) 90
HpyCH4V TGCA 5 cut(s) 215, 515, 775, 953, 990
HpyF10VI GCNNNNNNNGC 7 cut(s) 32, 41, 341, 687, 913, 922, 959
HpyF3I CTNAG 4 cut(s) 238, 503, 576, 939
HpySE526I ACGT 1 cut(s) 90
Hsp92II CATG 2 cut(s) 779, 950
Kpn2I TCCGGA 1 cut(s) 531
Kzo9I GATC 2 cut(s) 669, 763
LmnI GCTCC 3 cut(s) 49, 220, 937
Lsp1109I GCAGC 1 cut(s) 934
LweI GCATC 5 cut(s) 121, 184, 202, 265, 940
MaeI CTAG 1 cut(s) 827
MaeII ACGT 1 cut(s) 90
MaeIII GTNAC 3 cut(s) 345, 565, 857
MalI GATC 2 cut(s) 671, 765
MboI GATC 2 cut(s) 669, 763
MboII GAAGA 7 cut(s) 272, 293, 440, 485, 679, 792, 824
MhlI GDGCHC 1 cut(s) 37
MlsI TGGCCA 1 cut(s) 5
MluCI AATT 6 cut(s) 353, 526, 616, 783, 806, 833
MluNI TGGCCA 1 cut(s) 5
MlyI GAGTC 1 cut(s) 806
MmeI TCCRAC 1 cut(s) 77
Mox20I TGGCCA 1 cut(s) 5
MroI TCCGGA 1 cut(s) 531
MroXI GAANNNNTTC 1 cut(s) 411
MscI TGGCCA 1 cut(s) 5
MseI TTAA 3 cut(s) 642, 716, 849
Msp20I TGGCCA 1 cut(s) 5
MspA1I CMGCKG 2 cut(s) 59, 896
MspCI CTTAAG 1 cut(s) 715
MspI CCGG 2 cut(s) 532, 737
MspR9I CCNGG 2 cut(s) 737, 903
Mva1269I GAATGC 1 cut(s) 990
MvaI CCWGG 1 cut(s) 903
MwoI GCNNNNNNNGC 7 cut(s) 32, 41, 341, 687, 913, 922, 959
NciI CCSGG 1 cut(s) 737
NdeII GATC 2 cut(s) 669, 763
NlaIII CATG 2 cut(s) 779, 950
NlaIV GGNNCC 2 cut(s) 36, 45
NmeAIII GCCGAG 1 cut(s) 424
NmuCI GTSAC 2 cut(s) 345, 857
PcsI WCGNNNNNNNCGW 1 cut(s) 189
PctI GAATGC 1 cut(s) 990
PdmI GAANNNNTTC 1 cut(s) 411
PfeI GAWTC 4 cut(s) 233, 386, 407, 499
PkrI GCNGC 1 cut(s) 924
PleI GAGTC 1 cut(s) 805
PpsI GAGTC 1 cut(s) 805
PsiI TTATAA 1 cut(s) 696
Psp6I CCWGG 1 cut(s) 901
PspGI CCWGG 1 cut(s) 901
PspN4I GGNNCC 2 cut(s) 36, 45
PspPI GGNCC 2 cut(s) 899, 905
PstNI CAGNNNCTG 1 cut(s) 908
PvuII CAGCTG 2 cut(s) 59, 896
RsaI GTAC 2 cut(s) 268, 292
RsaNI GTAC 2 cut(s) 267, 291
SaqAI TTAA 3 cut(s) 642, 716, 849
SatI GCNGC 1 cut(s) 923
Sau3AI GATC 2 cut(s) 669, 763
Sau96I GGNCC 2 cut(s) 899, 905
SchI GAGTC 1 cut(s) 806
ScrFI CCNGG 2 cut(s) 737, 903
SduI GDGCHC 1 cut(s) 37
SfaNI GCATC 5 cut(s) 121, 184, 202, 265, 940
SinI GGWCC 1 cut(s) 899
SmlI CTYRAG 2 cut(s) 224, 715
SmoI CTYRAG 2 cut(s) 224, 715
Sse9I AATT 6 cut(s) 353, 526, 616, 783, 806, 833
SsiI CCGC 3 cut(s) 47, 124, 148
SspMI CTAG 1 cut(s) 827
StyD4I CCNGG 2 cut(s) 735, 901
StyI CCWWGG 1 cut(s) 966
TaaI ACNGT 4 cut(s) 185, 480, 702, 748
TaiI ACGT 1 cut(s) 93
TaqI TCGA 1 cut(s) 210
TasI AATT 6 cut(s) 353, 526, 616, 783, 806, 833
TatI WGTACW 1 cut(s) 266
TfiI GAWTC 4 cut(s) 233, 386, 407, 499
Tru1I TTAA 3 cut(s) 642, 716, 849
Tru9I TTAA 3 cut(s) 642, 716, 849
TscAI CASTG 2 cut(s) 567, 753
TseFI GTSAC 2 cut(s) 345, 857
TseI GCWGC 1 cut(s) 922
Tsp45I GTSAC 2 cut(s) 345, 857
TspDTI ATGAA 4 cut(s) 399, 447, 792, 846
TspGWI ACGGA 2 cut(s) 215, 756
TspRI CASTG 2 cut(s) 567, 753
Vha464I CTTAAG 1 cut(s) 715
VpaK11BI GGWCC 1 cut(s) 899
XapI RAATTY 2 cut(s) 806, 833
XmnI GAANNNNTTC 1 cut(s) 411
XspI CTAG 1 cut(s) 827
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.