Rorug03G0275200

Essential component of the PAM complex, a complex required for the translocation of transit peptide-containing proteins from the inner membrane into the mitochondrial matrix in an ATP-dependent manner

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000003
OG0004571
Physical Location & Seq
Forward (+)
27176477 .. 27179722
3246 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug03G0275200.1

Sequence Viewer

Length: 597 bp
ATGGGAAAACTGCGATTAAAAAACAGTAAGAAGAGATCTCAAGTACATAAAGAAGCATATTCTAGTCTAGTTGTGTCTTCAACTGGTACCTCTCCCTCAATCCCTGAGAAAGCTGAAGAAGATGTCACTCAAGCAGGAGCAAGAGCTCCATCTTCGTCTGACAAGACTTTTGCTGACCTTCGTGGCTTGGAGTTCGTTGACATATCATACAATCGATTATGGGGTCCGATTCCAGAAAACAAAGCATTTCAAGAAGCTCCTATAGACGCATTGCAAGGGAATCAAGGTCTGTGTGGCAATGCTACAGGTCTACAGCCCTGCACTAAGAATCCTGGCAAAAAGAAGCACAGCTCGAACATTGGTTACAAAGTCGTGTGCTTGGTAATCCCACCTGTGGTAGGAGTACTTATACTTGTTTTCTATGGAATTTATATCACTTACAGAAGAAAAAAGAATTGTCAAAAAACAGATGAAGAGGACTTGCACCTAAAGAATCCACAGTTTAGGCCTACCATGTATGACGTTTCTCAGTTTATAACAATGCAAATCGATCTCTCAGATAGAGTTGGACTAATACAAGGCTCAATATGTGTTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
GrpE

Protein Analysis

198

Amino Acids

21.88

Weight (kDa)

9.16

Isoelectric Point (pI)

45.93

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 536
Acc65I GGTACC 1 cut(s) 86
AccB1I GGYRCC 1 cut(s) 86
AccI GTMKAC 1 cut(s) 310
AcsI RAATTY 1 cut(s) 426
AcuI CTGAAG 1 cut(s) 135
AfaI GTAC 3 cut(s) 45, 88, 405
AfiI CCNNNNNNNGG 2 cut(s) 394, 398
AgsI TTSAA 2 cut(s) 81, 251
AjnI CCWGG 1 cut(s) 331
AluBI AGCT 4 cut(s) 113, 146, 257, 351
AluI AGCT 4 cut(s) 113, 146, 257, 351
Alw21I GWGCWC 1 cut(s) 148
AoxI GGCC 1 cut(s) 506
ApoI RAATTY 1 cut(s) 426
ArsI GACNNNNNNTTYG 2 cut(s) 152, 184
Asp718I GGTACC 1 cut(s) 86
AspS9I GGNCC 1 cut(s) 224
AvaII GGWCC 1 cut(s) 224
BanI GGYRCC 1 cut(s) 86
BanII GRGCYC 1 cut(s) 148
BbsI GAAGAC 1 cut(s) 69
Bbv12I GWGCWC 1 cut(s) 148
BccI CCATC 1 cut(s) 157
BciT130I CCWGG 1 cut(s) 333
BfaI CTAG 2 cut(s) 63, 68
BfmI CTRYAG 3 cut(s) 261, 303, 311
BglII AGATCT 1 cut(s) 35
BmcAI AGTACT 1 cut(s) 405
Bme1390I CCNGG 1 cut(s) 333
Bme18I GGWCC 1 cut(s) 224
BmgT120I GGNCC 1 cut(s) 224
BmiI GGNNCC 2 cut(s) 88, 225
BmrFI CCNGG 1 cut(s) 333
BpiI GAAGAC 1 cut(s) 69
BpuEI CTTGAG 2 cut(s) 24, 114
Bsa29I ATCGAT 2 cut(s) 214, 549
Bsc4I CCNNNNNNNGG 2 cut(s) 394, 398
Bse1I ACTGG 1 cut(s) 88
Bse3DI GCAATG 2 cut(s) 269, 304
BseBI CCWGG 1 cut(s) 333
BseCI ATCGAT 2 cut(s) 214, 549
BseLI CCNNNNNNNGG 2 cut(s) 394, 398
BseMI GCAATG 2 cut(s) 269, 304
BseMII CTCAG 3 cut(s) 96, 542, 570
BseNI ACTGG 1 cut(s) 88
BsgI GTGCAG 1 cut(s) 304
BshFI GGCC 1 cut(s) 508
BshNI GGYRCC 1 cut(s) 86
BshVI ATCGAT 2 cut(s) 214, 549
BsiHKAI GWGCWC 1 cut(s) 148
BslI CCNNNNNNNGG 2 cut(s) 394, 398
BsnI GGCC 1 cut(s) 508
Bsp1286I GDGCHC 1 cut(s) 148
Bsp143I GATC 2 cut(s) 35, 550
BspANI GGCC 1 cut(s) 508
BspCNI CTCAG 3 cut(s) 97, 541, 569
BspDI ATCGAT 2 cut(s) 214, 549
BspLI GGNNCC 2 cut(s) 88, 225
BspT107I GGYRCC 1 cut(s) 86
BsrDI GCAATG 2 cut(s) 269, 304
BsrI ACTGG 1 cut(s) 88
BssMI GATC 2 cut(s) 35, 550
Bst2UI CCWGG 1 cut(s) 333
Bst4CI ACNGT 2 cut(s) 26, 501
Bst6I CTCTTC 2 cut(s) 26, 468
BstDEI CTNAG 4 cut(s) 105, 324, 528, 556
BstENI CCTNNNNNAGG 1 cut(s) 396
BstKTI GATC 2 cut(s) 38, 553
BstMBI GATC 2 cut(s) 35, 550
BstNI CCWGG 1 cut(s) 333
BstSCI CCNGG 1 cut(s) 331
BstSFI CTRYAG 3 cut(s) 261, 303, 311
BstV2I GAAGAC 1 cut(s) 69
BstX2I RGATCY 1 cut(s) 35
BstYI RGATCY 1 cut(s) 35
Bsu15I ATCGAT 2 cut(s) 214, 549
BsuRI GGCC 1 cut(s) 508
BsuTUI ATCGAT 2 cut(s) 214, 549
Cfr13I GGNCC 1 cut(s) 224
ClaI ATCGAT 2 cut(s) 214, 549
CseI GACGC 1 cut(s) 275
Csp6I GTAC 3 cut(s) 44, 87, 404
CviAII CATG 1 cut(s) 514
CviJI RGCY 8 cut(s) 113, 146, 186, 257, 316, 351, 508, 582
CviKI_1 RGCY 8 cut(s) 113, 146, 186, 257, 316, 351, 508, 582
CviQI GTAC 3 cut(s) 44, 87, 404
DdeI CTNAG 4 cut(s) 105, 324, 528, 556
DpnI GATC 2 cut(s) 37, 552
DpnII GATC 2 cut(s) 35, 550
Eam1104I CTCTTC 2 cut(s) 26, 468
EarI CTCTTC 2 cut(s) 26, 468
Ecl136II GAGCTC 1 cut(s) 146
Eco147I AGGCCT 1 cut(s) 508
Eco24I GRGCYC 1 cut(s) 148
Eco47I GGWCC 1 cut(s) 224
Eco53kI GAGCTC 1 cut(s) 146
Eco57I CTGAAG 1 cut(s) 135
EcoICRI GAGCTC 1 cut(s) 146
EcoNI CCTNNNNNAGG 1 cut(s) 396
EcoRII CCWGG 1 cut(s) 331
EcoT38I GRGCYC 1 cut(s) 148
FaeI CATG 1 cut(s) 517
FatI CATG 1 cut(s) 513
FblI GTMKAC 1 cut(s) 310
FriOI GRGCYC 1 cut(s) 148
FspBI CTAG 2 cut(s) 63, 68
HaeIII GGCC 1 cut(s) 508
HgaI GACGC 1 cut(s) 275
Hin1II CATG 1 cut(s) 517
HincII GTYRAC 1 cut(s) 199
HindII GTYRAC 1 cut(s) 199
HinfI GANTC 4 cut(s) 229, 280, 328, 493
Hpy166II GTNNAC 2 cut(s) 199, 311
Hpy188I TCNGA 3 cut(s) 160, 228, 559
Hpy188III TCNNGA 2 cut(s) 233, 251
Hpy8I GTNNAC 2 cut(s) 199, 311
HpyAV CCTTC 1 cut(s) 188
HpyCH4III ACNGT 2 cut(s) 26, 501
HpyCH4IV ACGT 1 cut(s) 522
HpyCH4V TGCA 4 cut(s) 274, 321, 484, 544
HpyF3I CTNAG 4 cut(s) 105, 324, 528, 556
HpySE526I ACGT 1 cut(s) 522
Hsp92II CATG 1 cut(s) 517
KpnI GGTACC 1 cut(s) 90
Kzo9I GATC 2 cut(s) 35, 550
LmnI GCTCC 3 cut(s) 137, 151, 262
LpnPI CCDG 9 cut(s) 69, 117, 120, 246, 291, 318, 331, 345, 405
MaeI CTAG 2 cut(s) 63, 68
MaeII ACGT 1 cut(s) 522
MaeIII GTNAC 2 cut(s) 124, 362
MalI GATC 2 cut(s) 37, 552
MboI GATC 2 cut(s) 35, 550
MboII GAAGA 7 cut(s) 43, 69, 128, 131, 144, 456, 485
MflI RGATCY 1 cut(s) 35
MhlI GDGCHC 1 cut(s) 148
MluCI AATT 2 cut(s) 426, 454
MmeI TCCRAC 1 cut(s) 547
MnlI CCTC 3 cut(s) 100, 106, 469
MseI TTAA 1 cut(s) 17
MspR9I CCNGG 1 cut(s) 333
MvaI CCWGG 1 cut(s) 333
NdeII GATC 2 cut(s) 35, 550
NlaIII CATG 1 cut(s) 517
NlaIV GGNNCC 2 cut(s) 88, 225
NmuCI GTSAC 1 cut(s) 124
PceI AGGCCT 1 cut(s) 508
PfeI GAWTC 4 cut(s) 229, 280, 328, 493
PsiI TTATAA 1 cut(s) 536
Psp124BI GAGCTC 1 cut(s) 148
Psp6I CCWGG 1 cut(s) 331
PspGI CCWGG 1 cut(s) 331
PspN4I GGNNCC 2 cut(s) 88, 225
PspPI GGNCC 1 cut(s) 224
PsrI GAACNNNNNNTAC 2 cut(s) 347, 379
PsuI RGATCY 1 cut(s) 35
RsaI GTAC 3 cut(s) 45, 88, 405
RsaNI GTAC 3 cut(s) 44, 87, 404
SacI GAGCTC 1 cut(s) 148
SaqAI TTAA 1 cut(s) 17
Sau3AI GATC 2 cut(s) 35, 550
Sau96I GGNCC 1 cut(s) 224
ScaI AGTACT 1 cut(s) 405
ScrFI CCNGG 1 cut(s) 333
SduI GDGCHC 1 cut(s) 148
SfcI CTRYAG 3 cut(s) 261, 303, 311
SinI GGWCC 1 cut(s) 224
SmlI CTYRAG 2 cut(s) 39, 129
SmoI CTYRAG 2 cut(s) 39, 129
Sse9I AATT 2 cut(s) 426, 454
SseBI AGGCCT 1 cut(s) 508
SspMI CTAG 2 cut(s) 63, 68
SstI GAGCTC 1 cut(s) 148
StuI AGGCCT 1 cut(s) 508
StyD4I CCNGG 1 cut(s) 331
TaaI ACNGT 2 cut(s) 26, 501
TaiI ACGT 1 cut(s) 525
TaqI TCGA 3 cut(s) 214, 353, 549
TasI AATT 2 cut(s) 426, 454
TatI WGTACW 2 cut(s) 43, 403
TfiI GAWTC 4 cut(s) 229, 280, 328, 493
Tru1I TTAA 1 cut(s) 17
Tru9I TTAA 1 cut(s) 17
TseFI GTSAC 1 cut(s) 124
Tsp45I GTSAC 1 cut(s) 124
TspDTI ATGAA 1 cut(s) 486
VpaK11BI GGWCC 1 cut(s) 224
XagI CCTNNNNNAGG 1 cut(s) 396
XapI RAATTY 1 cut(s) 426
XmiI GTMKAC 1 cut(s) 310
XspI CTAG 2 cut(s) 63, 68
ZrmI AGTACT 1 cut(s) 405
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.