Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0004140.1

Orthogroup ID

OG0015702

Physical Location & Seq

Genomic Coordinates Reverse (-)

32573 .. 33738

Gene Structure 1166 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0004140.1_g000006.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 471 bp

atgatgcacaaggtggacgagggtggcgaaggaactgccagcaggatgagcaaggtggttggcgtgcttcttgcgcggggctggagtgagtgtgcgctggctgtcgacgtgctgcaagctagctgtgtgcgggagctgcgggggcaggctgttgtcttgcgagttgggcaaggctgcagtgcagaaaagcaaggttgcagcgaggaggtaggctggtgggctggtgcgcaggttgcggaggctacaggggagggctgcaggctgtggtgtgcagctagggttgaaggctgcgatctgcgagattcaagcagagtaataatgcttgggcgtggacatggaggcaagggtttgggtaaggaaggagcaaaacgacattgtaaggtcttccgcgacagcatccagggcaacaagctggcgacggctcggttctcaaggtcggcgaggagaaggagatcggaaagcaaggcttga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

ko05034 ko05202 ko05203 ko05322 map05034 map05202 map05203 map05322

Pfam Domains

Protein Families

CENP-T_C Histone

Protein Analysis

156

Amino Acids

16.72

Weight (kDa)

9.6

Isoelectric Point (pI)

56.53

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0015702)

Species	Orthologous Gene IDs
malus_domestica	MD03G1067400.v1.1 MD07G1131900.v1.1 MD07G1146700.v1.1 MD11G1096900.v1.1 MD14G1181800.v1.1
prunus_persica	Prupe.2G224400_v2.0.a1 Prupe.3G163200_v2.0.a1
rosa_chinensis	RchiOBHm_Chr6g0277791 RchiOBHm_Chr6g0282951
rosa_multiflora	Rmu_sc0004140.1_g000006
rosa_roxburghii	Rroxscaffold_6G00399880
rosa_rugosa	Rorug06G0385900
rosa_samantha	Rh2AG556600 Rh5AG417400 Rh6DG219000 Rh7AG433800

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
Acc16I	TGCGCA	1 cut(s)	228
Acc36I	ACCTGC	1 cut(s)	220
AccI	GTMKAC	1 cut(s)	105
AccII	CGCG	2 cut(s)	76, 390
AciI	CCGC	5 cut(s)	76, 130, 139, 236, 388
AdeI	CACNNNGTG	1 cut(s)	13
AgsI	TTSAA	2 cut(s)	284, 306
AjiI	CACGTC	1 cut(s)	109
AjnI	CCWGG	1 cut(s)	399
AluBI	AGCT	5 cut(s)	119, 123, 136, 275, 412
AluI	AGCT	5 cut(s)	119, 123, 136, 275, 412
ApeKI	GCWGC	7 cut(s)	112, 136, 174, 198, 255, 272, 288
AspLEI	GCGC	3 cut(s)	76, 97, 229
AsuNHI	GCTAGC	1 cut(s)	119
BbsI	GAAGAC	1 cut(s)	376
BbvI	GCAGC	7 cut(s)	99, 123, 161, 210, 242, 275, 284
BceAI	ACGGC	1 cut(s)	435
BcgI	CGANNNNNNTGC	2 cut(s)	17, 51
BciT130I	CCWGG	1 cut(s)	401
BfaI	CTAG	2 cut(s)	120, 276
BfmI	CTRYAG	3 cut(s)	175, 243, 256
BfuAI	ACCTGC	1 cut(s)	220
BisI	GCNGC	7 cut(s)	113, 137, 175, 199, 256, 273, 289
BlsI	GCNGC	7 cut(s)	114, 138, 176, 200, 257, 274, 290
Bme1390I	CCNGG	1 cut(s)	401
BmgBI	CACGTC	1 cut(s)	109
BmrFI	CCNGG	1 cut(s)	401
BmsI	GCATC	1 cut(s)	405
BmtI	GCTAGC	1 cut(s)	123
BpiI	GAAGAC	1 cut(s)	376
BpmI	CTGGAG	1 cut(s)	103
BpuEI	CTTGAG	1 cut(s)	415
BsaJI	CCNNGG	1 cut(s)	400
BsaXI	ACNNNNNCTCC	2 cut(s)	76, 106
BseBI	CCWGG	1 cut(s)	401
BseDI	CCNNGG	1 cut(s)	400
BseGI	GGATG	2 cut(s)	51, 396
BseRI	GAGGAG	2 cut(s)	218, 457
BseXI	GCAGC	7 cut(s)	99, 123, 161, 210, 242, 275, 284
BsgI	GTGCAG	2 cut(s)	201, 291
Bsh1236I	CGCG	2 cut(s)	76, 390
Bsp143I	GATC	2 cut(s)	292, 452
BspACI	CCGC	5 cut(s)	76, 130, 139, 236, 388
BspFNI	CGCG	2 cut(s)	76, 390
BspMAI	CTGCAG	2 cut(s)	179, 260
BspMI	ACCTGC	1 cut(s)	220
BspOI	GCTAGC	1 cut(s)	123
BssECI	CCNNGG	1 cut(s)	400
BssMI	GATC	2 cut(s)	292, 452
Bst2UI	CCWGG	1 cut(s)	401
BstC8I	GCNNGC	8 cut(s)	40, 65, 99, 117, 121, 147, 260, 414
BstF5I	GGATG	2 cut(s)	51, 396
BstFNI	CGCG	2 cut(s)	76, 390
BstHHI	GCGC	3 cut(s)	76, 97, 229
BstKTI	GATC	2 cut(s)	295, 455
BstMBI	GATC	2 cut(s)	292, 452
BstMWI	GCNNNNNNNGC	7 cut(s)	48, 73, 136, 142, 166, 233, 402
BstNI	CCWGG	1 cut(s)	401
BstSCI	CCNGG	1 cut(s)	399
BstSFI	CTRYAG	3 cut(s)	175, 243, 256
BstUI	CGCG	2 cut(s)	76, 390
BstV1I	GCAGC	7 cut(s)	99, 123, 161, 210, 242, 275, 284
BstV2I	GAAGAC	1 cut(s)	376
BtrI	CACGTC	1 cut(s)	109
BtsCI	GGATG	2 cut(s)	51, 396
BtsI	GCAGTG	1 cut(s)	184
BtsIMutI	CAGTG	1 cut(s)	184
BveI	ACCTGC	1 cut(s)	220
Cac8I	GCNNGC	8 cut(s)	40, 65, 99, 117, 121, 147, 260, 414
CfoI	GCGC	3 cut(s)	76, 97, 229
CviAII	CATG	1 cut(s)	335
DpnI	GATC	2 cut(s)	294, 454
DpnII	GATC	2 cut(s)	292, 452
DraIII	CACNNNGTG	1 cut(s)	13
EcoRII	CCWGG	1 cut(s)	399
FaeI	CATG	1 cut(s)	338
FaiI	YATR	1 cut(s)	336
FalI	AAGNNNNNCTT	1 cut(s)	451
FatI	CATG	1 cut(s)	334
FauI	CCCGC	3 cut(s)	69, 123, 132
FblI	GTMKAC	1 cut(s)	105
Fnu4HI	GCNGC	7 cut(s)	113, 137, 175, 199, 256, 273, 289
FokI	GGATG	2 cut(s)	58, 383
Fsp4HI	GCNGC	7 cut(s)	113, 137, 175, 199, 256, 273, 289
FspBI	CTAG	2 cut(s)	120, 276
FspI	TGCGCA	1 cut(s)	228
GlaI	GCGC	3 cut(s)	75, 96, 228
GluI	GCNGC	7 cut(s)	113, 137, 175, 199, 256, 273, 289
GsuI	CTGGAG	1 cut(s)	103
HhaI	GCGC	3 cut(s)	76, 97, 229
Hin1II	CATG	1 cut(s)	338
Hin6I	GCGC	3 cut(s)	74, 95, 227
HinP1I	GCGC	3 cut(s)	74, 95, 227
HincII	GTYRAC	1 cut(s)	106
HindII	GTYRAC	1 cut(s)	106
HinfI	GANTC	1 cut(s)	302
Hpy166II	GTNNAC	3 cut(s)	16, 106, 332
Hpy188I	TCNGA	1 cut(s)	457
Hpy8I	GTNNAC	3 cut(s)	16, 106, 332
Hpy99I	CGWCG	2 cut(s)	110, 421
HpyAV	CCTTC	4 cut(s)	23, 278, 353, 441
HpyCH4IV	ACGT	1 cut(s)	108
HpyCH4V	TGCA	7 cut(s)	7, 115, 177, 182, 198, 258, 272
HpyF10VI	GCNNNNNNNGC	7 cut(s)	48, 73, 136, 142, 166, 233, 402
HpySE526I	ACGT	1 cut(s)	108
Hsp92II	CATG	1 cut(s)	338
HspAI	GCGC	3 cut(s)	74, 95, 227
Kzo9I	GATC	2 cut(s)	292, 452
LmnI	GCTCC	2 cut(s)	133, 362
Lsp1109I	GCAGC	7 cut(s)	99, 123, 161, 210, 242, 275, 284
LweI	GCATC	1 cut(s)	405
MaeI	CTAG	2 cut(s)	120, 276
MaeII	ACGT	1 cut(s)	108
MalI	GATC	2 cut(s)	294, 454
MboI	GATC	2 cut(s)	292, 452
MboII	GAAGA	1 cut(s)	376
MnlI	CCTC	7 cut(s)	13, 196, 199, 232, 244, 332, 435
MspR9I	CCNGG	1 cut(s)	401
MvaI	CCWGG	1 cut(s)	401
MvnI	CGCG	2 cut(s)	76, 390
MwoI	GCNNNNNNNGC	7 cut(s)	48, 73, 136, 142, 166, 233, 402
NdeII	GATC	2 cut(s)	292, 452
NheI	GCTAGC	1 cut(s)	119
NlaIII	CATG	1 cut(s)	338
NsbI	TGCGCA	1 cut(s)	228
PcsI	WCGNNNNNNNCGW	1 cut(s)	24
PfeI	GAWTC	1 cut(s)	302
PkrI	GCNGC	7 cut(s)	114, 138, 176, 200, 257, 274, 290
Psp6I	CCWGG	1 cut(s)	399
PspGI	CCWGG	1 cut(s)	399
PstI	CTGCAG	2 cut(s)	179, 260
SalI	GTCGAC	1 cut(s)	104
SatI	GCNGC	7 cut(s)	113, 137, 175, 199, 256, 273, 289
Sau3AI	GATC	2 cut(s)	292, 452
ScrFI	CCNGG	1 cut(s)	401
SfaNI	GCATC	1 cut(s)	405
SfcI	CTRYAG	3 cut(s)	175, 243, 256
SmlI	CTYRAG	1 cut(s)	430
SmoI	CTYRAG	1 cut(s)	430
SsiI	CCGC	5 cut(s)	76, 130, 139, 236, 388
SspMI	CTAG	2 cut(s)	120, 276
StyD4I	CCNGG	1 cut(s)	399
TaiI	ACGT	1 cut(s)	111
TaqI	TCGA	1 cut(s)	105
TfiI	GAWTC	1 cut(s)	302
TscAI	CASTG	1 cut(s)	184
TseI	GCWGC	7 cut(s)	112, 136, 174, 198, 255, 272, 288
TspRI	CASTG	1 cut(s)	184
XmiI	GTMKAC	1 cut(s)	105
XspI	CTAG	2 cut(s)	120, 276

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.