Basic Information

Type: gene

Biological Identity

Species

rosa_samantha

Chromosome

Chr2A

Orthogroup ID

OG0015702

Physical Location & Seq

Genomic Coordinates Reverse (-)

78701218 .. 78706034

Gene Structure 4817 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rh2AG556600.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 453 bp

ATGCAGAGAAGCAGAACATCAAATGTCATCGGGCTGATTGGGATTGGGGCCGAAATCAGAATTCTCGAAGAGGACGCCGGAGTGGAGGAGGCCAGGGCAGAAGATGGCGAGCTTGTGGAGGGAGGACCAGCCGCCGCGAGGCTCGGAGGAGGCGGCGGAGACAAGATCGAAGACGACGGAGCAAGGCGTGGAAATGGAGGCGCAGATCGACATCGTAAGGTCTTCCGCGAAAGCATCCAGGGCATAAAGCCGGTGACGGCTCAGTTCTCAAGGTCGGCGAGGAGAAGGAGATCAGAAAGCAGGGATATTGAAGAAGGAACTCCTCACTATATCCCAAGCTTGAGAGACTGCCTATTGGTTGATCTTAAAGAGCTTGCAGACCCATCTTTTAACTCCCAGCAACAGAGGGAAAGGTTCTCACATCTTTTGCATCTGGCTGTGCTACCTCATTAG

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

150

Amino Acids

16.46

Weight (kDa)

6.22

Isoelectric Point (pI)

68.72

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0015702)

Species	Orthologous Gene IDs
malus_domestica	MD03G1067400.v1.1 MD07G1131900.v1.1 MD07G1146700.v1.1 MD11G1096900.v1.1 MD14G1181800.v1.1
prunus_persica	Prupe.2G224400_v2.0.a1 Prupe.3G163200_v2.0.a1
rosa_chinensis	RchiOBHm_Chr6g0277791 RchiOBHm_Chr6g0282951
rosa_multiflora	Rmu_sc0004140.1_g000006
rosa_roxburghii	Rroxscaffold_6G00399880
rosa_rugosa	Rorug06G0385900
rosa_samantha	Rh2AG556600 Rh5AG417400 Rh6DG219000 Rh7AG433800

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccII	CGCG	2 cut(s)	137, 228
AciI	CCGC	5 cut(s)	132, 135, 153, 156, 226
AcsI	RAATTY	1 cut(s)	60
AcyI	GRCGYC	1 cut(s)	75
AfiI	CCNNNNNNNGG	1 cut(s)	138
AgsI	TTSAA	1 cut(s)	311
AjnI	CCWGG	2 cut(s)	92, 237
AluBI	AGCT	3 cut(s)	112, 339, 373
AluI	AGCT	3 cut(s)	112, 339, 373
Alw26I	GTCTC	2 cut(s)	153, 339
AoxI	GGCC	2 cut(s)	48, 90
ApoI	RAATTY	1 cut(s)	60
AspLEI	GCGC	1 cut(s)	203
AspS9I	GGNCC	2 cut(s)	48, 125
AsuHPI	GGTGA	1 cut(s)	265
AvaII	GGWCC	1 cut(s)	125
BbsI	GAAGAC	2 cut(s)	177, 214
BccI	CCATC	2 cut(s)	98, 391
BceAI	ACGGC	1 cut(s)	273
BciT130I	CCWGG	2 cut(s)	94, 239
BcoDI	GTCTC	2 cut(s)	153, 339
BisI	GCNGC	3 cut(s)	132, 135, 154
BlsI	GCNGC	3 cut(s)	133, 136, 155
Bme1390I	CCNGG	2 cut(s)	94, 239
Bme18I	GGWCC	1 cut(s)	125
BmgT120I	GGNCC	2 cut(s)	48, 125
BmiI	GGNNCC	1 cut(s)	49
BmrFI	CCNGG	2 cut(s)	94, 239
BmsI	GCATC	2 cut(s)	243, 439
BpiI	GAAGAC	2 cut(s)	177, 214
BpuEI	CTTGAG	2 cut(s)	253, 361
BsaBI	GATNNNNATC	1 cut(s)	210
BsaHI	GRCGYC	1 cut(s)	75
BsaJI	CCNNGG	2 cut(s)	93, 238
Bsc4I	CCNNNNNNNGG	1 cut(s)	138
Bse118I	RCCGGY	1 cut(s)	250
Bse8I	GATNNNNATC	1 cut(s)	210
BseBI	CCWGG	2 cut(s)	94, 239
BseDI	CCNNGG	2 cut(s)	93, 238
BseGI	GGATG	1 cut(s)	234
BseJI	GATNNNNATC	1 cut(s)	210
BseLI	CCNNNNNNNGG	1 cut(s)	138
BseMII	CTCAG	1 cut(s)	275
BseRI	GAGGAG	4 cut(s)	101, 162, 295, 312
BseYI	CCCAGC	1 cut(s)	396
Bsh1236I	CGCG	2 cut(s)	137, 228
BshFI	GGCC	2 cut(s)	50, 92
BsiSI	CCGG	2 cut(s)	78, 251
BslI	CCNNNNNNNGG	1 cut(s)	138
BsmAI	GTCTC	2 cut(s)	153, 339
BsnI	GGCC	2 cut(s)	50, 92
Bsp143I	GATC	4 cut(s)	165, 205, 290, 361
BspACI	CCGC	5 cut(s)	132, 135, 153, 156, 226
BspANI	GGCC	2 cut(s)	50, 92
BspCNI	CTCAG	1 cut(s)	274
BspFNI	CGCG	2 cut(s)	137, 228
BspLI	GGNNCC	1 cut(s)	49
BsrFI	RCCGGY	1 cut(s)	250
BssAI	RCCGGY	1 cut(s)	250
BssECI	CCNNGG	2 cut(s)	93, 238
BssMI	GATC	4 cut(s)	165, 205, 290, 361
BssNI	GRCGYC	1 cut(s)	75
Bst2UI	CCWGG	2 cut(s)	94, 239
Bst6I	CTCTTC	1 cut(s)	63
BstACI	GRCGYC	1 cut(s)	75
BstC8I	GCNNGC	2 cut(s)	110, 375
BstDEI	CTNAG	1 cut(s)	261
BstF5I	GGATG	1 cut(s)	234
BstFNI	CGCG	2 cut(s)	137, 228
BstHHI	GCGC	1 cut(s)	203
BstKTI	GATC	4 cut(s)	168, 208, 293, 364
BstMAI	GTCTC	2 cut(s)	153, 339
BstMBI	GATC	4 cut(s)	165, 205, 290, 361
BstMWI	GCNNNNNNNGC	1 cut(s)	240
BstNI	CCWGG	2 cut(s)	94, 239
BstSCI	CCNGG	2 cut(s)	92, 237
BstUI	CGCG	2 cut(s)	137, 228
BstV2I	GAAGAC	2 cut(s)	177, 214
BsuRI	GGCC	2 cut(s)	50, 92
BtsCI	GGATG	1 cut(s)	234
Cac8I	GCNNGC	2 cut(s)	110, 375
CfoI	GCGC	1 cut(s)	203
Cfr10I	RCCGGY	1 cut(s)	250
Cfr13I	GGNCC	2 cut(s)	48, 125
CseI	GACGC	1 cut(s)	83
DdeI	CTNAG	1 cut(s)	261
DpnI	GATC	4 cut(s)	167, 207, 292, 363
DpnII	GATC	4 cut(s)	165, 205, 290, 361
Eam1104I	CTCTTC	1 cut(s)	63
EarI	CTCTTC	1 cut(s)	63
EciI	GGCGGA	1 cut(s)	171
Eco47I	GGWCC	1 cut(s)	125
EcoRI	GAATTC	1 cut(s)	60
EcoRII	CCWGG	2 cut(s)	92, 237
FaiI	YATR	2 cut(s)	245, 330
Fnu4HI	GCNGC	3 cut(s)	132, 135, 154
FokI	GGATG	1 cut(s)	221
Fsp4HI	GCNGC	3 cut(s)	132, 135, 154
GlaI	GCGC	1 cut(s)	202
GluI	GCNGC	3 cut(s)	132, 135, 154
GsaI	CCCAGC	1 cut(s)	400
HaeIII	GGCC	2 cut(s)	50, 92
HapII	CCGG	2 cut(s)	78, 251
HgaI	GACGC	1 cut(s)	83
HhaI	GCGC	1 cut(s)	203
Hin1I	GRCGYC	1 cut(s)	75
Hin6I	GCGC	1 cut(s)	201
HinP1I	GCGC	1 cut(s)	201
HindIII	AAGCTT	1 cut(s)	337
HpaII	CCGG	2 cut(s)	78, 251
HphI	GGTGA	1 cut(s)	265
Hpy188I	TCNGA	3 cut(s)	59, 146, 295
Hpy188III	TCNNGA	1 cut(s)	65
Hpy99I	CGWCG	1 cut(s)	179
HpyAV	CCTTC	2 cut(s)	279, 308
HpyCH4V	TGCA	3 cut(s)	4, 377, 430
HpyF10VI	GCNNNNNNNGC	1 cut(s)	240
HpyF3I	CTNAG	1 cut(s)	261
Hsp92I	GRCGYC	1 cut(s)	75
HspAI	GCGC	1 cut(s)	201
Kzo9I	GATC	4 cut(s)	165, 205, 290, 361
LmnI	GCTCC	1 cut(s)	179
LweI	GCATC	2 cut(s)	243, 439
MaeIII	GTNAC	1 cut(s)	253
MalI	GATC	4 cut(s)	167, 207, 292, 363
MboI	GATC	4 cut(s)	165, 205, 290, 361
MboII	GAAGA	5 cut(s)	80, 113, 182, 214, 323
MluCI	AATT	1 cut(s)	60
MseI	TTAA	2 cut(s)	366, 390
MspI	CCGG	2 cut(s)	78, 251
MspR9I	CCNGG	2 cut(s)	94, 239
MvaI	CCWGG	2 cut(s)	94, 239
MvnI	CGCG	2 cut(s)	137, 228
MwoI	GCNNNNNNNGC	1 cut(s)	240
NdeII	GATC	4 cut(s)	165, 205, 290, 361
NlaIV	GGNNCC	1 cut(s)	49
NmuCI	GTSAC	1 cut(s)	253
PkrI	GCNGC	3 cut(s)	133, 136, 155
Psp6I	CCWGG	2 cut(s)	92, 237
PspFI	CCCAGC	1 cut(s)	396
PspGI	CCWGG	2 cut(s)	92, 237
PspN4I	GGNNCC	1 cut(s)	49
PspPI	GGNCC	2 cut(s)	48, 125
SaqAI	TTAA	2 cut(s)	366, 390
SatI	GCNGC	3 cut(s)	132, 135, 154
Sau3AI	GATC	4 cut(s)	165, 205, 290, 361
Sau96I	GGNCC	2 cut(s)	48, 125
ScrFI	CCNGG	2 cut(s)	94, 239
SetI	ASST	7 cut(s)	114, 222, 275, 341, 375, 416, 448
SfaNI	GCATC	2 cut(s)	243, 439
SinI	GGWCC	1 cut(s)	125
SmlI	CTYRAG	2 cut(s)	268, 340
SmoI	CTYRAG	2 cut(s)	268, 340
Sse9I	AATT	1 cut(s)	60
SsiI	CCGC	5 cut(s)	132, 135, 153, 156, 226
StyD4I	CCNGG	2 cut(s)	92, 237
TaqI	TCGA	3 cut(s)	66, 168, 208
TasI	AATT	1 cut(s)	60
TauI	GCSGC	3 cut(s)	134, 137, 156
Tru1I	TTAA	2 cut(s)	366, 390
Tru9I	TTAA	2 cut(s)	366, 390
TseFI	GTSAC	1 cut(s)	253
Tsp45I	GTSAC	1 cut(s)	253
TspGWI	ACGGA	1 cut(s)	192
VpaK11BI	GGWCC	1 cut(s)	125
XapI	RAATTY	1 cut(s)	60

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.