Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0004189.1

Orthogroup ID

OG0014820

Physical Location & Seq

Genomic Coordinates Reverse (-)

182534 .. 182884

Gene Structure 351 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0004189.1_g000039.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 351 bp

atgccatacttaaggcgtataaattcaaatacctcctcaaagatctatgctagcaggacactgcttttcttgagaagtgatggaactttccaaccattggtgattgaactgagcttgcctcatcctgatggagatcaactcagtcgcattagcagtgtgctcacaccagctgaaggaggtgtggaaagctccatatggcagctggccaaagcttatgttgccgtaaatgactctggagttcatcaacttatcagtcactggtattactcttttaaacaatccttggggaacaagttcatctttgaaaatttgacagaagtcttatccaactgcagaaaccagaagatatag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003824 GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0008150 GO:0008152 GO:0016165 GO:0016491 GO:0016701 GO:0016702 GO:0044424 GO:0044464 GO:0051213 GO:0055114

KEGG Pathways

Metabolic & Signaling

ko00591 ko00592 ko01100 ko01110 map00591 map00592 map01100 map01110

Pfam Domains

Protein Families

Lipoxygenase PLAT

Protein Analysis

116

Amino Acids

13.1

Weight (kDa)

8.82

Isoelectric Point (pI)

54.96

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0014820)

Species	Orthologous Gene IDs
malus_domestica	MD05G1339500.v1.1
rosa_chinensis	RchiOBHm_Chr6g0308151
rosa_laevigata	RLG00000025409
rosa_multiflora	Rmu_co8047918.1_g000001 Rmu_co8430331.1_g000001 Rmu_sc0001665.1_g000008 Rmu_sc0004189.1_g000039 Rmu_sc0005706.1_g000008 Rmu_sc0019919.1_g000003
rosa_roxburghii	Rroxscaffold_2G00085130 Rroxscaffold_7G00160430 Rroxscaffold_7G00160510
rosa_samantha	Rh5CG072100 Rh5CG072700 Rh5DG010100 Rh5DG063800 Rh6AG473300

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB7I	CCANNNNNTGG	1 cut(s)	97
AcoI	YGGCCR	1 cut(s)	204
AcsI	RAATTY	2 cut(s)	22, 307
AcuI	CTGAAG	1 cut(s)	192
AfiI	CCNNNNNNNGG	2 cut(s)	97, 173
AflII	CTTAAG	1 cut(s)	10
AgsI	TTSAA	3 cut(s)	27, 107, 305
AluBI	AGCT	5 cut(s)	114, 170, 189, 202, 212
AluI	AGCT	5 cut(s)	114, 170, 189, 202, 212
Alw21I	GWGCWC	1 cut(s)	162
AlwNI	CAGNNNCTG	1 cut(s)	258
AoxI	GGCC	1 cut(s)	204
ApeKI	GCWGC	1 cut(s)	199
ApoI	RAATTY	2 cut(s)	22, 307
Asp700I	GAANNNNTTC	1 cut(s)	293
AsuHPI	GGTGA	1 cut(s)	112
AsuNHI	GCTAGC	1 cut(s)	50
BalI	TGGCCA	1 cut(s)	206
Bbv12I	GWGCWC	1 cut(s)	162
BbvI	GCAGC	1 cut(s)	211
BccI	CCATC	2 cut(s)	74, 122
BceAI	ACGGC	1 cut(s)	206
BfaI	CTAG	1 cut(s)	51
BfmI	CTRYAG	1 cut(s)	331
BfrI	CTTAAG	1 cut(s)	10
BglII	AGATCT	1 cut(s)	42
BisI	GCNGC	1 cut(s)	200
BlsI	GCNGC	1 cut(s)	201
BmtI	GCTAGC	1 cut(s)	54
BoxI	GACNNNNGTC	1 cut(s)	317
BplI	GAGNNNNNCTC	4 cut(s)	103, 135, 123, 155
BpmI	CTGGAG	1 cut(s)	255
BpuEI	CTTGAG	1 cut(s)	91
BsaBI	GATNNNNATC	1 cut(s)	132
BsaJI	CCNNGG	1 cut(s)	282
Bsc4I	CCNNNNNNNGG	2 cut(s)	97, 173
Bse1I	ACTGG	1 cut(s)	263
Bse8I	GATNNNNATC	1 cut(s)	132
BseDI	CCNNGG	1 cut(s)	282
BseGI	GGATG	1 cut(s)	121
BseJI	GATNNNNATC	1 cut(s)	132
BseLI	CCNNNNNNNGG	2 cut(s)	97, 173
BseMII	CTCAG	2 cut(s)	101, 154
BseNI	ACTGG	1 cut(s)	263
BseRI	GAGGAG	1 cut(s)	25
BseXI	GCAGC	1 cut(s)	211
BshFI	GGCC	1 cut(s)	206
BsiHKAI	GWGCWC	1 cut(s)	162
BslI	CCNNNNNNNGG	2 cut(s)	97, 173
BsnI	GGCC	1 cut(s)	206
Bsp1286I	GDGCHC	1 cut(s)	162
Bsp143I	GATC	2 cut(s)	42, 133
BspANI	GGCC	1 cut(s)	206
BspCNI	CTCAG	2 cut(s)	102, 153
BspMAI	CTGCAG	1 cut(s)	335
BspOI	GCTAGC	1 cut(s)	54
BspTI	CTTAAG	1 cut(s)	10
BsrI	ACTGG	1 cut(s)	263
BssECI	CCNNGG	1 cut(s)	282
BssMI	GATC	2 cut(s)	42, 133
BssT1I	CCWWGG	1 cut(s)	282
BstAFI	CTTAAG	1 cut(s)	10
BstC8I	GCNNGC	3 cut(s)	52, 116, 204
BstDEI	CTNAG	2 cut(s)	110, 140
BstF5I	GGATG	1 cut(s)	121
BstKTI	GATC	2 cut(s)	45, 136
BstMBI	GATC	2 cut(s)	42, 133
BstMWI	GCNNNNNNNGC	1 cut(s)	218
BstPAI	GACNNNNGTC	1 cut(s)	317
BstSFI	CTRYAG	1 cut(s)	331
BstV1I	GCAGC	1 cut(s)	211
BstX2I	RGATCY	1 cut(s)	42
BstYI	RGATCY	1 cut(s)	42
BsuRI	GGCC	1 cut(s)	206
BtsCI	GGATG	1 cut(s)	121
BtsI	GCAGTG	2 cut(s)	59, 160
BtsIMutI	CAGTG	3 cut(s)	59, 160, 256
Cac8I	GCNNGC	3 cut(s)	52, 116, 204
CaiI	CAGNNNCTG	1 cut(s)	258
CviJI	RGCY	6 cut(s)	114, 170, 189, 202, 206, 212
CviKI_1	RGCY	6 cut(s)	114, 170, 189, 202, 206, 212
DdeI	CTNAG	2 cut(s)	110, 140
DpnI	GATC	2 cut(s)	44, 135
DpnII	GATC	2 cut(s)	42, 133
DraI	TTTAAA	1 cut(s)	274
EaeI	YGGCCR	1 cut(s)	204
Eco130I	CCWWGG	1 cut(s)	282
Eco57I	CTGAAG	1 cut(s)	192
EcoT14I	CCWWGG	1 cut(s)	282
ErhI	CCWWGG	1 cut(s)	282
FaiI	YATR	7 cut(s)	7, 20, 48, 194, 196, 216, 349
FalI	AAGNNNNNCTT	2 cut(s)	284, 316
FauNDI	CATATG	1 cut(s)	194
Fnu4HI	GCNGC	1 cut(s)	200
FokI	GGATG	1 cut(s)	108
Fsp4HI	GCNGC	1 cut(s)	200
FspBI	CTAG	1 cut(s)	51
GluI	GCNGC	1 cut(s)	200
GsuI	CTGGAG	1 cut(s)	255
HaeIII	GGCC	1 cut(s)	206
HindIII	AAGCTT	1 cut(s)	210
HinfI	GANTC	1 cut(s)	230
HphI	GGTGA	1 cut(s)	112
Hpy188III	TCNNGA	3 cut(s)	70, 125, 234
HpyAV	CCTTC	1 cut(s)	167
HpyCH4V	TGCA	1 cut(s)	333
HpyF10VI	GCNNNNNNNGC	1 cut(s)	218
HpyF3I	CTNAG	2 cut(s)	110, 140
Kzo9I	GATC	2 cut(s)	42, 133
LmnI	GCTCC	1 cut(s)	194
LpnPI	CCDG	6 cut(s)	40, 138, 180, 188, 219, 244
Lsp1109I	GCAGC	1 cut(s)	211
MaeI	CTAG	1 cut(s)	51
MaeIII	GTNAC	1 cut(s)	254
MalI	GATC	2 cut(s)	44, 135
MboI	GATC	2 cut(s)	42, 133
MflI	RGATCY	1 cut(s)	42
MhlI	GDGCHC	1 cut(s)	162
MlsI	TGGCCA	1 cut(s)	206
MluCI	AATT	2 cut(s)	22, 307
MluNI	TGGCCA	1 cut(s)	206
MlyI	GAGTC	1 cut(s)	224
MmeI	TCCRAC	2 cut(s)	115, 351
MnlI	CCTC	4 cut(s)	43, 46, 129, 170
Mox20I	TGGCCA	1 cut(s)	206
MroXI	GAANNNNTTC	1 cut(s)	293
MscI	TGGCCA	1 cut(s)	206
MseI	TTAA	2 cut(s)	11, 273
MslI	CAYNNNNRTG	1 cut(s)	126
Msp20I	TGGCCA	1 cut(s)	206
MspA1I	CMGCKG	2 cut(s)	170, 202
MspCI	CTTAAG	1 cut(s)	10
MwoI	GCNNNNNNNGC	1 cut(s)	218
NdeI	CATATG	1 cut(s)	194
NdeII	GATC	2 cut(s)	42, 133
NheI	GCTAGC	1 cut(s)	50
NmuCI	GTSAC	1 cut(s)	254
PdmI	GAANNNNTTC	1 cut(s)	293
PflMI	CCANNNNNTGG	1 cut(s)	97
PkrI	GCNGC	1 cut(s)	201
PleI	GAGTC	1 cut(s)	224
PpsI	GAGTC	1 cut(s)	224
PshAI	GACNNNNGTC	1 cut(s)	317
PstI	CTGCAG	1 cut(s)	335
PstNI	CAGNNNCTG	1 cut(s)	258
PsuI	RGATCY	1 cut(s)	42
PvuII	CAGCTG	2 cut(s)	170, 202
RseI	CAYNNNNRTG	1 cut(s)	126
SaqAI	TTAA	2 cut(s)	11, 273
SatI	GCNGC	1 cut(s)	200
Sau3AI	GATC	2 cut(s)	42, 133
SchI	GAGTC	1 cut(s)	224
SduI	GDGCHC	1 cut(s)	162
SetI	ASST	7 cut(s)	35, 116, 172, 181, 191, 204, 214
SfcI	CTRYAG	1 cut(s)	331
SmiMI	CAYNNNNRTG	1 cut(s)	126
SmlI	CTYRAG	2 cut(s)	10, 70
SmoI	CTYRAG	2 cut(s)	10, 70
Sse9I	AATT	2 cut(s)	22, 307
SspMI	CTAG	1 cut(s)	51
StyI	CCWWGG	1 cut(s)	282
TasI	AATT	2 cut(s)	22, 307
Tru1I	TTAA	2 cut(s)	11, 273
Tru9I	TTAA	2 cut(s)	11, 273
TscAI	CASTG	3 cut(s)	66, 160, 263
TseFI	GTSAC	1 cut(s)	254
TseI	GCWGC	1 cut(s)	199
Tsp45I	GTSAC	1 cut(s)	254
TspDTI	ATGAA	2 cut(s)	230, 286
TspRI	CASTG	3 cut(s)	66, 160, 263
Van91I	CCANNNNNTGG	1 cut(s)	97
Vha464I	CTTAAG	1 cut(s)	10
XapI	RAATTY	2 cut(s)	22, 307
XcmI	CCANNNNNNNNNTGG	1 cut(s)	199
XmnI	GAANNNNTTC	1 cut(s)	293
XspI	CTAG	1 cut(s)	51

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.