Rroxscaffold_2G00085130

Plant lipoxygenase may be involved in a number of diverse aspects of plant physiology including growth and development, pest resistance, and senescence or responses to wounding

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000002
OG0014820
Physical Location & Seq
Reverse (-)
7508032 .. 7509662
1631 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_2G00085130.1

Sequence Viewer

Length: 240 bp
ATGCCCCATTTTGGTTCAAACAGGGGAATGTGTTATTTACCTTCAGTTTTGGTTTGGATTGCATGTAAGTTGGAGAAGTTGGGTTTATGTGGAGAAGTGCAGGCTTCTATGGCACTCAAGAGCAACAAGCTATTCGTATTAGACCATCGGAATGCATTGATGCCATACTTACGGCATATAAATTCAAATACCTCCTCAAAGATATATGCTAGCGAGACACTGCTTTTCTTGAAAAAGTGA

Protein Analysis

79

Amino Acids

8.93

Weight (kDa)

9.56

Isoelectric Point (pI)

45.0

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Lipoxygenase PF00305 33 - 79 1.6e-12 Lipoxygenase
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 181
AcuI CTGAAG 1 cut(s) 27
AfiI CCNNNNNNNGG 1 cut(s) 11
AgsI TTSAA 3 cut(s) 18, 186, 232
AluBI AGCT 1 cut(s) 130
AluI AGCT 1 cut(s) 130
Alw26I GTCTC 1 cut(s) 209
ApoI RAATTY 1 cut(s) 181
AsuNHI GCTAGC 1 cut(s) 209
BccI CCATC 1 cut(s) 153
BceAI ACGGC 1 cut(s) 188
BcoDI GTCTC 1 cut(s) 209
BfaI CTAG 1 cut(s) 210
BmsI GCATC 1 cut(s) 150
BmtI GCTAGC 1 cut(s) 213
BpuEI CTTGAG 1 cut(s) 101
Bsc4I CCNNNNNNNGG 1 cut(s) 11
BseLI CCNNNNNNNGG 1 cut(s) 11
BseRI GAGGAG 1 cut(s) 184
BsgI GTGCAG 1 cut(s) 119
BslI CCNNNNNNNGG 1 cut(s) 11
BsmAI GTCTC 1 cut(s) 209
BsmI GAATGC 1 cut(s) 157
BspOI GCTAGC 1 cut(s) 213
BstC8I GCNNGC 2 cut(s) 102, 211
BstMAI GTCTC 1 cut(s) 209
BstMWI GCNNNNNNNGC 1 cut(s) 110
BstNSI RCATGY 1 cut(s) 66
BtsI GCAGTG 1 cut(s) 218
BtsIMutI CAGTG 1 cut(s) 218
Cac8I GCNNGC 2 cut(s) 102, 211
CviAII CATG 1 cut(s) 63
CviJI RGCY 2 cut(s) 104, 130
CviKI_1 RGCY 2 cut(s) 104, 130
Eco57I CTGAAG 1 cut(s) 27
EcoT22I ATGCAT 1 cut(s) 157
FaeI CATG 1 cut(s) 66
FaiI YATR 8 cut(s) 64, 88, 110, 166, 177, 179, 205, 207
FatI CATG 1 cut(s) 62
FspBI CTAG 1 cut(s) 210
Hin1II CATG 1 cut(s) 66
Hpy188I TCNGA 1 cut(s) 150
Hpy188III TCNNGA 2 cut(s) 118, 229
HpyAV CCTTC 1 cut(s) 51
HpyCH4V TGCA 3 cut(s) 62, 100, 155
HpyF10VI GCNNNNNNNGC 1 cut(s) 110
Hsp92II CATG 1 cut(s) 66
LpnPI CCDG 2 cut(s) 7, 86
LweI GCATC 1 cut(s) 150
MaeI CTAG 1 cut(s) 210
MluCI AATT 1 cut(s) 181
MmeI TCCRAC 1 cut(s) 51
MnlI CCTC 2 cut(s) 202, 205
Mph1103I ATGCAT 1 cut(s) 157
MslI CAYNNNNRTG 1 cut(s) 150
Mva1269I GAATGC 1 cut(s) 157
MwoI GCNNNNNNNGC 1 cut(s) 110
NheI GCTAGC 1 cut(s) 209
NlaIII CATG 1 cut(s) 66
NsiI ATGCAT 1 cut(s) 157
NspI RCATGY 1 cut(s) 66
PctI GAATGC 1 cut(s) 157
RseI CAYNNNNRTG 1 cut(s) 150
SetI ASST 3 cut(s) 43, 132, 194
SfaNI GCATC 1 cut(s) 150
SgeI CNNG 7 cut(s) 34, 75, 113, 130, 139, 222, 226
SmiMI CAYNNNNRTG 1 cut(s) 150
SmlI CTYRAG 1 cut(s) 116
SmoI CTYRAG 1 cut(s) 116
Sse9I AATT 1 cut(s) 181
SspMI CTAG 1 cut(s) 210
TasI AATT 1 cut(s) 181
TscAI CASTG 1 cut(s) 225
TspRI CASTG 1 cut(s) 225
XapI RAATTY 1 cut(s) 181
XceI RCATGY 1 cut(s) 66
XspI CTAG 1 cut(s) 210
Zsp2I ATGCAT 1 cut(s) 157
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.