Rh5DG010100

Plant lipoxygenase may be involved in a number of diverse aspects of plant physiology including growth and development, pest resistance, and senescence or responses to wounding

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5D
OG0014820
Physical Location & Seq
Reverse (-)
714461 .. 721050
6590 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5DG010100.1

Sequence Viewer

Length: 216 bp
ATGAGCTTCTCCGATTTCAATTGGGCTATTCTGGGCACGGCTGAAACAAACACTTCTTCAGATCATCATGAGGCATTGATGCCATACTTAAGGCGTATAAATTCAAATACCTCCTTAAAGATCTATGCTAGCAGGACACTGCTTTTCTTGAAAAGTGATGGAACTTTCCAGCCATTGGTGATTGAACTAAGCTTGCCTCATCCTGATGGAGATTAA

Protein Analysis

71

Amino Acids

7.98

Weight (kDa)

5.4

Isoelectric Point (pI)

41.25

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Lipoxygenase PF00305 21 - 68 2e-16 Lipoxygenase
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 175
AcsI RAATTY 1 cut(s) 100
AcuI CTGAAG 1 cut(s) 42
AfiI CCNNNNNNNGG 1 cut(s) 175
AflII CTTAAG 1 cut(s) 88
AgsI TTSAA 4 cut(s) 19, 105, 151, 185
AluBI AGCT 2 cut(s) 6, 192
AluI AGCT 2 cut(s) 6, 192
ApoI RAATTY 1 cut(s) 100
AsuHPI GGTGA 1 cut(s) 190
AsuNHI GCTAGC 1 cut(s) 128
BaeGI GKGCMC 1 cut(s) 38
BccI CCATC 2 cut(s) 152, 200
BceAI ACGGC 1 cut(s) 54
BfaI CTAG 1 cut(s) 129
BfrI CTTAAG 1 cut(s) 88
BglII AGATCT 1 cut(s) 120
BmsI GCATC 1 cut(s) 69
BmtI GCTAGC 1 cut(s) 132
Bsc4I CCNNNNNNNGG 1 cut(s) 175
BseGI GGATG 1 cut(s) 199
BseLI CCNNNNNNNGG 1 cut(s) 175
BseSI GKGCMC 1 cut(s) 38
BslI CCNNNNNNNGG 1 cut(s) 175
Bsp1286I GDGCHC 1 cut(s) 38
Bsp143I GATC 2 cut(s) 61, 120
BspHI TCATGA 1 cut(s) 67
BspOI GCTAGC 1 cut(s) 132
BspTI CTTAAG 1 cut(s) 88
BssMI GATC 2 cut(s) 61, 120
BstAFI CTTAAG 1 cut(s) 88
BstC8I GCNNGC 2 cut(s) 130, 194
BstDEI CTNAG 1 cut(s) 188
BstF5I GGATG 1 cut(s) 199
BstKTI GATC 2 cut(s) 64, 123
BstMBI GATC 2 cut(s) 61, 120
BstSLI GKGCMC 1 cut(s) 38
BstX2I RGATCY 1 cut(s) 120
BstYI RGATCY 1 cut(s) 120
BtsCI GGATG 1 cut(s) 199
BtsI GCAGTG 1 cut(s) 137
BtsIMutI CAGTG 1 cut(s) 137
Cac8I GCNNGC 2 cut(s) 130, 194
CciI TCATGA 1 cut(s) 67
CviAII CATG 1 cut(s) 68
CviJI RGCY 5 cut(s) 6, 26, 41, 172, 192
CviKI_1 RGCY 5 cut(s) 6, 26, 41, 172, 192
DdeI CTNAG 1 cut(s) 188
DpnI GATC 2 cut(s) 63, 122
DpnII GATC 2 cut(s) 61, 120
Eco57I CTGAAG 1 cut(s) 42
FaeI CATG 1 cut(s) 71
FaiI YATR 4 cut(s) 69, 85, 98, 126
FatI CATG 1 cut(s) 67
FokI GGATG 1 cut(s) 186
FspBI CTAG 1 cut(s) 129
Hin1II CATG 1 cut(s) 71
HindIII AAGCTT 1 cut(s) 190
HphI GGTGA 1 cut(s) 190
Hpy188I TCNGA 2 cut(s) 13, 61
Hpy188III TCNNGA 3 cut(s) 68, 148, 203
HpyF3I CTNAG 1 cut(s) 188
Hsp92II CATG 1 cut(s) 71
Kzo9I GATC 2 cut(s) 61, 120
LpnPI CCDG 3 cut(s) 17, 118, 182
LweI GCATC 1 cut(s) 69
MaeI CTAG 1 cut(s) 129
MalI GATC 2 cut(s) 63, 122
MboI GATC 2 cut(s) 61, 120
MboII GAAGA 1 cut(s) 48
MfeI CAATTG 1 cut(s) 19
MflI RGATCY 1 cut(s) 120
MhlI GDGCHC 1 cut(s) 38
MluCI AATT 2 cut(s) 19, 100
MnlI CCTC 3 cut(s) 64, 121, 207
MseI TTAA 3 cut(s) 89, 116, 214
MslI CAYNNNNRTG 1 cut(s) 204
MspCI CTTAAG 1 cut(s) 88
MunI CAATTG 1 cut(s) 19
NdeII GATC 2 cut(s) 61, 120
NheI GCTAGC 1 cut(s) 128
NlaIII CATG 1 cut(s) 71
PagI TCATGA 1 cut(s) 67
PflMI CCANNNNNTGG 1 cut(s) 175
PsuI RGATCY 1 cut(s) 120
RseI CAYNNNNRTG 1 cut(s) 204
SaqAI TTAA 3 cut(s) 89, 116, 214
Sau3AI GATC 2 cut(s) 61, 120
SduI GDGCHC 1 cut(s) 38
SetI ASST 3 cut(s) 8, 113, 194
SfaNI GCATC 1 cut(s) 69
SgeI CNNG 8 cut(s) 44, 49, 80, 141, 145, 160, 181, 205
SmiMI CAYNNNNRTG 1 cut(s) 204
SmlI CTYRAG 1 cut(s) 88
SmoI CTYRAG 1 cut(s) 88
Sse9I AATT 2 cut(s) 19, 100
SspMI CTAG 1 cut(s) 129
TasI AATT 2 cut(s) 19, 100
Tru1I TTAA 3 cut(s) 89, 116, 214
Tru9I TTAA 3 cut(s) 89, 116, 214
TscAI CASTG 1 cut(s) 144
TspRI CASTG 1 cut(s) 144
Van91I CCANNNNNTGG 1 cut(s) 175
Vha464I CTTAAG 1 cut(s) 88
XapI RAATTY 1 cut(s) 100
XspI CTAG 1 cut(s) 129
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.