Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0004260.1

Orthogroup ID

OG0014070

Physical Location & Seq

Genomic Coordinates Reverse (-)

6023 .. 6343

Gene Structure 321 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0004260.1_g000004.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 321 bp

atggtggtgggagtatccaaaggatttgagaagaggctacagttgattggcgttggttatagagcaacactagaagggaggattttggtattgagtcttgggttctcccatccagttaggatggatcttcctgatggcatacaagtgaaggtggaagaaaacaccagaatcatagttagtggatatgacaagagtgaaattggtcagtttgctgcttccatcaggaaatggagacccccagagccatacaaaggtaagggagtgaaatatgctgatgaaattgtaagaagaaaggaaggaaaagcaggaaagaagaagtaa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0000003 GO:0003006 GO:0003674 GO:0003676 GO:0003723 GO:0003735 GO:0005198 GO:0005488 GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0007275 GO:0008150 GO:0009507 GO:0009526 GO:0009532 GO:0009536 GO:0009570 GO:0009719 GO:0009725 GO:0009735 GO:0009790 GO:0009791 GO:0009793 GO:0009941 GO:0010033 GO:0010154 GO:0016020 GO:0022414 GO:0031967 GO:0031975 GO:0032501 GO:0032502 GO:0042221 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044422 GO:0044424 GO:0044434 GO:0044435 GO:0044444 GO:0044446 GO:0044464 GO:0048316 GO:0048608 GO:0048731 GO:0048856 GO:0050896 GO:0061458 GO:0097159 GO:1901363

KEGG Pathways

Metabolic & Signaling

ko03010 map03010

Pfam Domains

Protein Families

Ribosomal_L6

Protein Analysis

106

Amino Acids

11.86

Weight (kDa)

10.04

Isoelectric Point (pI)

28.84

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0014070)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G05190
fragaria_vesca	FvH4_6g43280
malus_domestica	MD09G1107800.v1.1 MD09G1108400.v1.1 MD17G1096300.v1.1
prunus_persica	Prupe.1G100300_v2.0.a1
pyrus_communis	pycom09g03090 pycom17g09240
rosa_chinensis	RchiOBHm_Chr2g0159551
rosa_laevigata	RLG00000021165
rosa_multiflora	Rmu_sc0004260.1_g000004 Rmu_sc0012414.1_g000013
rosa_roxburghii	Rroxscaffold_2G00090410
rosa_rugosa	Rorug02G0476800
rosa_samantha	Rh2BG556800 Rh2CG527000
rosa_wichuraiana	Rw2G044970

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AclWI	GGATC	1 cut(s)	132
AfiI	CCNNNNNNNGG	1 cut(s)	251
Alw26I	GTCTC	1 cut(s)	226
AlwI	GGATC	1 cut(s)	132
ApeKI	GCWGC	1 cut(s)	212
BbvI	GCAGC	1 cut(s)	199
BccI	CCATC	4 cut(s)	115, 117, 128, 227
BciVI	GTATCC	1 cut(s)	25
BcoDI	GTCTC	1 cut(s)	226
BfaI	CTAG	1 cut(s)	71
BfmI	CTRYAG	1 cut(s)	38
BfuI	GTATCC	1 cut(s)	25
BisI	GCNGC	1 cut(s)	213
BlsI	GCNGC	1 cut(s)	214
BsaI	GGTCTC	1 cut(s)	226
Bsc4I	CCNNNNNNNGG	1 cut(s)	251
Bse1I	ACTGG	1 cut(s)	113
BseGI	GGATG	2 cut(s)	109, 126
BseLI	CCNNNNNNNGG	1 cut(s)	251
BseNI	ACTGG	1 cut(s)	113
BseXI	GCAGC	1 cut(s)	199
BslI	CCNNNNNNNGG	1 cut(s)	251
BsmAI	GTCTC	1 cut(s)	226
Bso31I	GGTCTC	1 cut(s)	226
Bsp143I	GATC	1 cut(s)	124
BspPI	GGATC	1 cut(s)	132
BspTNI	GGTCTC	1 cut(s)	226
BsrI	ACTGG	1 cut(s)	113
BssMI	GATC	1 cut(s)	124
Bst4CI	ACNGT	1 cut(s)	42
Bst6I	CTCTTC	1 cut(s)	26
BstF5I	GGATG	2 cut(s)	109, 126
BstKTI	GATC	1 cut(s)	127
BstMAI	GTCTC	1 cut(s)	226
BstMBI	GATC	1 cut(s)	124
BstSFI	CTRYAG	1 cut(s)	38
BstV1I	GCAGC	1 cut(s)	199
BstX2I	RGATCY	1 cut(s)	124
BstYI	RGATCY	1 cut(s)	124
BsuI	GTATCC	1 cut(s)	25
BtsCI	GGATG	2 cut(s)	109, 126
CviJI	RGCY	2 cut(s)	37, 244
CviKI_1	RGCY	2 cut(s)	37, 244
DpnI	GATC	1 cut(s)	126
DpnII	GATC	1 cut(s)	124
Eam1104I	CTCTTC	1 cut(s)	26
EarI	CTCTTC	1 cut(s)	26
Eco31I	GGTCTC	1 cut(s)	226
FaiI	YATR	6 cut(s)	60, 140, 173, 186, 247, 270
Fnu4HI	GCNGC	1 cut(s)	213
FokI	GGATG	2 cut(s)	96, 133
Fsp4HI	GCNGC	1 cut(s)	213
FspBI	CTAG	1 cut(s)	71
GluI	GCNGC	1 cut(s)	213
HinfI	GANTC	2 cut(s)	94, 168
Hpy188III	TCNNGA	2 cut(s)	131, 223
HpyAV	CCTTC	3 cut(s)	68, 142, 290
HpyCH4III	ACNGT	1 cut(s)	42
Kzo9I	GATC	1 cut(s)	124
LpnPI	CCDG	6 cut(s)	126, 144, 178, 208, 252, 291
Lsp1109I	GCAGC	1 cut(s)	199
MaeI	CTAG	1 cut(s)	71
MalI	GATC	1 cut(s)	126
MboI	GATC	1 cut(s)	124
MboII	GAAGA	4 cut(s)	43, 119, 167, 300
MflI	RGATCY	1 cut(s)	124
MluCI	AATT	2 cut(s)	198, 279
MlyI	GAGTC	1 cut(s)	103
MnlI	CCTC	2 cut(s)	27, 72
MslI	CAYNNNNRTG	1 cut(s)	143
NdeII	GATC	1 cut(s)	124
PfeI	GAWTC	1 cut(s)	168
PkrI	GCNGC	1 cut(s)	214
PleI	GAGTC	1 cut(s)	102
PpsI	GAGTC	1 cut(s)	102
PsuI	RGATCY	1 cut(s)	124
RseI	CAYNNNNRTG	1 cut(s)	143
SatI	GCNGC	1 cut(s)	213
Sau3AI	GATC	1 cut(s)	124
SchI	GAGTC	1 cut(s)	103
SetI	ASST	2 cut(s)	153, 256
SfcI	CTRYAG	1 cut(s)	38
SgeI	CNNG	9 cut(s)	83, 110, 125, 143, 155, 177, 202, 235, 251
SmiMI	CAYNNNNRTG	1 cut(s)	143
Sse9I	AATT	2 cut(s)	198, 279
SspMI	CTAG	1 cut(s)	71
TaaI	ACNGT	1 cut(s)	42
TasI	AATT	2 cut(s)	198, 279
TfiI	GAWTC	1 cut(s)	168
TseI	GCWGC	1 cut(s)	212
TspDTI	ATGAA	1 cut(s)	291
XspI	CTAG	1 cut(s)	71

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.