Rmu_sc0004458.1_g000004

Classical arabinogalactan protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0004458.1
Physical Location & Seq
Reverse (-)
12085 .. 12675
591 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0004458.1_g000004.1.cds

Sequence Viewer

Length: 591 bp
atggccactctaattcatgcagggttgtattctcttctagttttagctctctacaccaactttgtaaaccctttctaccaagttagtggatccacggcagcagtcccggcagcacccccggcagcaccacctgcagcacccccggcagcacccccagcagcaccccccgcagcaccaccagcagcaccaccggcagcacccccggcagcacccccagcagcacccccagcagcaccaccggcagcaccccccgcagcaccaccggcagcaccacctgcatcaccccccgcagcacccccggcagcaccaccggcagcaccccccgcagcacccccggcagcaccaccagcagcacccccaacagcacccccaacacctaagttaccgccgccacatgacataacacctccaggaggaccaccacagaaaaaagggtctaaaggactgagtggtggacagaaggcggggatagttttcggagtgctaatcggggtagggctgctcggttttggcgcatttgtgtacaagaaacgtagtgataacgtgagaagagaaagatatggagttgcagccaggagaacctccctttga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

196

Amino Acids

18.83

Weight (kDa)

10.45

Isoelectric Point (pI)

90.14

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0013018)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AarI CACCTGC 2 cut(s) 139, 283
Acc36I ACCTGC 2 cut(s) 139, 283
AciI CCGC 7 cut(s) 168, 252, 288, 324, 386, 389, 464
AclWI GGATC 2 cut(s) 84, 97
AcoI YGGCCR 1 cut(s) 3
AfaI GTAC 1 cut(s) 524
AfiI CCNNNNNNNGG 1 cut(s) 413
AjnI CCWGG 2 cut(s) 409, 572
AluBI AGCT 1 cut(s) 47
AluI AGCT 1 cut(s) 47
AlwI GGATC 2 cut(s) 84, 97
AoxI GGCC 1 cut(s) 3
AspLEI GCGC 1 cut(s) 515
AspS9I GGNCC 1 cut(s) 416
AsuC2I CCSGG 6 cut(s) 107, 119, 143, 203, 299, 335
AsuHPI GGTGA 1 cut(s) 273
AvaII GGWCC 1 cut(s) 416
BalI TGGCCA 1 cut(s) 5
BamHI GGATCC 1 cut(s) 89
BceAI ACGGC 1 cut(s) 111
BciT130I CCWGG 2 cut(s) 411, 574
BcnI CCSGG 6 cut(s) 107, 119, 143, 203, 299, 335
BfaI CTAG 1 cut(s) 38
BfmI CTRYAG 1 cut(s) 132
BfuAI ACCTGC 2 cut(s) 139, 283
Bme1390I CCNGG 8 cut(s) 107, 119, 143, 203, 299, 335, 411, 574
Bme18I GGWCC 1 cut(s) 416
BmgT120I GGNCC 1 cut(s) 416
BmiI GGNNCC 1 cut(s) 91
BmrFI CCNGG 8 cut(s) 107, 119, 143, 203, 299, 335, 411, 574
BmsI GCATC 1 cut(s) 287
BpmI CTGGAG 1 cut(s) 393
BpuMI CCSGG 6 cut(s) 107, 119, 143, 203, 299, 335
BsaJI CCNNGG 6 cut(s) 93, 117, 141, 201, 297, 333
Bsc4I CCNNNNNNNGG 1 cut(s) 413
Bse118I RCCGGY 4 cut(s) 190, 238, 262, 310
BseBI CCWGG 2 cut(s) 411, 574
BseDI CCNNGG 6 cut(s) 93, 117, 141, 201, 297, 333
BseLI CCNNNNNNNGG 1 cut(s) 413
BseMII CTCAG 1 cut(s) 437
BseYI CCCAGC 3 cut(s) 154, 214, 226
BshFI GGCC 1 cut(s) 5
BslFI GGGAC 1 cut(s) 89
BslI CCNNNNNNNGG 1 cut(s) 413
BsmFI GGGAC 1 cut(s) 89
BsnI GGCC 1 cut(s) 5
Bsp1407I TGTACA 1 cut(s) 522
Bsp143I GATC 1 cut(s) 89
BspACI CCGC 7 cut(s) 168, 252, 288, 324, 386, 389, 464
BspANI GGCC 1 cut(s) 5
BspCNI CTCAG 1 cut(s) 438
BspLI GGNNCC 1 cut(s) 91
BspMAI CTGCAG 1 cut(s) 136
BspMI ACCTGC 2 cut(s) 139, 283
BspPI GGATC 2 cut(s) 84, 97
BsrFI RCCGGY 4 cut(s) 190, 238, 262, 310
BsrGI TGTACA 1 cut(s) 522
BssAI RCCGGY 4 cut(s) 190, 238, 262, 310
BssECI CCNNGG 6 cut(s) 93, 117, 141, 201, 297, 333
BssMI GATC 1 cut(s) 89
Bst2UI CCWGG 2 cut(s) 411, 574
Bst6I CTCTTC 2 cut(s) 39, 544
BstAPI GCANNNNNTGC 2 cut(s) 131, 275
BstAUI TGTACA 1 cut(s) 522
BstDEI CTNAG 2 cut(s) 378, 446
BstDSI CCRYGG 1 cut(s) 93
BstENI CCTNNNNNAGG 1 cut(s) 411
BstHHI GCGC 1 cut(s) 515
BstKTI GATC 1 cut(s) 92
BstMBI GATC 1 cut(s) 89
BstNI CCWGG 2 cut(s) 411, 574
BstSCI CCNGG 8 cut(s) 105, 117, 141, 201, 297, 333, 409, 572
BstSFI CTRYAG 1 cut(s) 132
BstX2I RGATCY 1 cut(s) 89
BstXI CCANNNNNNTGG 1 cut(s) 86
BstYI RGATCY 1 cut(s) 89
BsuRI GGCC 1 cut(s) 5
BtgI CCRYGG 1 cut(s) 93
BveI ACCTGC 2 cut(s) 139, 283
CfoI GCGC 1 cut(s) 515
Cfr10I RCCGGY 4 cut(s) 190, 238, 262, 310
Cfr13I GGNCC 1 cut(s) 416
Csp6I GTAC 1 cut(s) 523
CviAII CATG 2 cut(s) 17, 395
CviJI RGCY 4 cut(s) 5, 47, 499, 572
CviKI_1 RGCY 4 cut(s) 5, 47, 499, 572
CviQI GTAC 1 cut(s) 523
DdeI CTNAG 2 cut(s) 378, 446
DpnI GATC 1 cut(s) 91
DpnII GATC 1 cut(s) 89
EaeI YGGCCR 1 cut(s) 3
Eam1104I CTCTTC 2 cut(s) 39, 544
EarI CTCTTC 2 cut(s) 39, 544
Eco47I GGWCC 1 cut(s) 416
EcoNI CCTNNNNNAGG 1 cut(s) 411
EcoRII CCWGG 2 cut(s) 409, 572
FaeI CATG 2 cut(s) 20, 398
FaiI YATR 4 cut(s) 18, 396, 401, 561
FaqI GGGAC 1 cut(s) 89
FatI CATG 2 cut(s) 16, 394
FauI CCCGC 5 cut(s) 175, 259, 295, 331, 457
FspBI CTAG 1 cut(s) 38
GlaI GCGC 1 cut(s) 514
GsaI CCCAGC 3 cut(s) 158, 218, 230
GsuI CTGGAG 1 cut(s) 393
HaeIII GGCC 1 cut(s) 5
HhaI GCGC 1 cut(s) 515
Hin1II CATG 2 cut(s) 20, 398
Hin6I GCGC 1 cut(s) 513
HinP1I GCGC 1 cut(s) 513
HphI GGTGA 1 cut(s) 273
Hpy166II GTNNAC 3 cut(s) 67, 455, 523
Hpy188I TCNGA 1 cut(s) 479
Hpy8I GTNNAC 3 cut(s) 67, 455, 523
HpyAV CCTTC 1 cut(s) 454
HpyCH4IV ACGT 2 cut(s) 532, 543
HpyCH4V TGCA 4 cut(s) 20, 134, 278, 569
HpyF3I CTNAG 2 cut(s) 378, 446
HpySE526I ACGT 2 cut(s) 532, 543
Hsp92II CATG 2 cut(s) 20, 398
HspAI GCGC 1 cut(s) 513
Kzo9I GATC 1 cut(s) 89
LweI GCATC 1 cut(s) 287
MaeI CTAG 1 cut(s) 38
MaeII ACGT 2 cut(s) 532, 543
MaeIII GTNAC 1 cut(s) 381
MalI GATC 1 cut(s) 91
MboI GATC 1 cut(s) 89
MboII GAAGA 2 cut(s) 26, 561
MflI RGATCY 1 cut(s) 89
MlsI TGGCCA 1 cut(s) 5
MluCI AATT 1 cut(s) 12
MluNI TGGCCA 1 cut(s) 5
MnlI CCTC 2 cut(s) 407, 417
Mox20I TGGCCA 1 cut(s) 5
MscI TGGCCA 1 cut(s) 5
Msp20I TGGCCA 1 cut(s) 5
MspR9I CCNGG 8 cut(s) 107, 119, 143, 203, 299, 335, 411, 574
MvaI CCWGG 2 cut(s) 411, 574
NciI CCSGG 6 cut(s) 107, 119, 143, 203, 299, 335
NdeII GATC 1 cut(s) 89
NlaIII CATG 2 cut(s) 20, 398
NlaIV GGNNCC 1 cut(s) 91
PaqCI CACCTGC 2 cut(s) 139, 283
PfoI TCCNGGA 1 cut(s) 409
Psp6I CCWGG 2 cut(s) 409, 572
PspFI CCCAGC 3 cut(s) 154, 214, 226
PspGI CCWGG 2 cut(s) 409, 572
PspN4I GGNNCC 1 cut(s) 91
PspPI GGNCC 1 cut(s) 416
PstI CTGCAG 1 cut(s) 136
PsuI RGATCY 1 cut(s) 89
RsaI GTAC 1 cut(s) 524
RsaNI GTAC 1 cut(s) 523
Sau3AI GATC 1 cut(s) 89
Sau96I GGNCC 1 cut(s) 416
ScrFI CCNGG 8 cut(s) 107, 119, 143, 203, 299, 335, 411, 574
SetI ASST 8 cut(s) 49, 133, 277, 379, 409, 535, 546, 584
SfaNI GCATC 1 cut(s) 287
SfcI CTRYAG 1 cut(s) 132
SinI GGWCC 1 cut(s) 416
Sse9I AATT 1 cut(s) 12
SsiI CCGC 7 cut(s) 168, 252, 288, 324, 386, 389, 464
SspMI CTAG 1 cut(s) 38
StyD4I CCNGG 8 cut(s) 105, 117, 141, 201, 297, 333, 409, 572
TaiI ACGT 2 cut(s) 535, 546
TasI AATT 1 cut(s) 12
TatI WGTACW 1 cut(s) 522
TauI GCSGC 1 cut(s) 391
TspDTI ATGAA 1 cut(s) 5
VpaK11BI GGWCC 1 cut(s) 416
XagI CCTNNNNNAGG 1 cut(s) 411
XspI CTAG 1 cut(s) 38
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.